Korean Journal of Microbiology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2383-9902   pISSN 0440-2413

Table. 2.

Table. 2.

CRISPR/Cas systems, repeat and anti-repeat sequences of L. curvatus, L. fuchuensis, L. graminis, and L. sakei strains

Strains CRISPR Type Spacer count Repeat sequence Anti-repeat sequences
1. L. curvatus MRS6 II-A 45 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
ucacugauuugauacucuucuaaaacuacaaaccua
2. L. curvatus TMW 1.1928 II-A 20 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
I-E 29 gaatcatccccatgtatatggggagcac -
3. L. curvatus WiKim52 II-A 29 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
I-E 19 gaatcatccccatgtatatggggagcac -
4. L. curvatus IRG2 II-A 16 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
5. L. curvatus WiKim38 II-A 8 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
6. L. curvatus CBA3617 II-A 6 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
7. L. curvatus NFH-Km12 II-A 47 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
8. L. curvatus FBA2 II-A 14 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
9. L. curvatus JCM 1096= DSM 20019 II-A 15 gttgaactactcattgatttgatactcttctaaaac -
10. L. curvatus FLEC03 II-A 10 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
11. L. curvatus VRA_2sq_f II-A 31 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
12. L. curvatus VRA_2sq_n II-A 31 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
13. L. curvatus MGYG-HGUT-00020 II-A 30 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
14. L. curvatus SRCM103465 ND ND ND ND
15. L. curvatus KG6 ND ND ND ND
16. L. curvatus ZJUNIT8 ND ND ND ND
17. L. curvatus RI-198 ND ND ND ND
18. L. curvatus strain RI-193 ND ND ND ND
19. L. graminis DSM 20719 II-A 34 gttgaactactcattgatttgatactcttctaaaac ugauuugauacucuucuaaaacuacaaaccuacaaa
acucaaucgaaauacucauugauuugauacucugag
20. L. graminis LG542 II-A 34 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
ugauuugauacucuucuaaaacuacaaaccuacaaa
21. L. fuchuensis DSM 14340 II-A 10 gttgatgaactcattgatttgatactcttctaaaac augcacuuuaacaccggauguggaucccgccuaug
22. L. fuchuensis MFPC41A2801 II-A 42 gttgatgaactcattgatttgatactcttctaaaac ucucaaccgauaaacucauugauuugauacucugg
23. L. sakei Probio65 ND ND ND ND
24. L. sakei WiKim0073 ND ND ND ND
25. L. sakei J18 II-C 92 gctattgtttccttcaacattcggttaagatgaaac ND
26. L. sakei J112 II-A 14 gttttagaagagtatcaaatcaatgagtagttcaac ND
27. L. sakei J160x1 II-A 24 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
28. L. sakei J156 ND ND ND ND
29. L. sakei ye2 ND ND ND ND
30. L. sakei CBA3614 ND ND ND ND
31. L. sakei DSM 20017=JCM 1157 (LT13) ND ND ND ND
32. L. sakei DS4 II-C 26 gctattgtttccttcaacattcggttaagatgaaat uacuauuguguccuucaaacacucgguuaagaugaag
33. L. sakei J64 ND ND ND ND
34. L. sakei CBA3635 ND ND ND ND
35. L. sakei MFPB16A1401 ND ND ND ND
36. L. sakei MBEL1397 ND ND ND ND
37. L. sakei WiKim0063 ND ND ND ND
38. L. sakei MFPB19 ND ND ND ND
39. L. sakei WiKim0072 ND ND ND ND
40. L. sakei J54 II-A 29 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
41. L. sakei ZFM220 ND ND ND ND
42. L. sakei ZFM225 ND ND ND ND
43. L. sakei LZ217 ND ND ND ND
44. L. sakei ZFM229 ND ND ND ND
45. L. sakei LK-145 ND ND ND ND
46. L. sakei WiKim0074 ND ND ND ND
47. L. sakei FAM18311 ND ND ND ND
48. L. sakei FLEC01 II-A 35 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
49. L. sakei 23K ND ND ND ND
50. L. sakei DSM 15831 II-A 11 gttttagaagagtatcaaatcaatgagtagttcaac accgaaauacucauugauuugauacucugaguuaaaa
51. L. sakei RI-404 II-A 36 gttttagaagagtatcaaatcaatgagtggttcaac accgaaauacucauugauuugauacucugaguuaaa
52. L. sakei L15 ND ND ND ND
53. L. sakei RI-517 ND ND ND ND
54. L. sakei RI-409 ND ND ND ND

ND, Not detected.

Bold subtype was categorized according to CRISPR location (Schuster et al., 2019)

Korean J. Microbiol. 2021;57:12-22 https://doi.org/10.7845/kjm.2021.0093
© 2021 Korean J. Microbiol.