Korean Journal of Microbiology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2383-9902   pISSN 0440-2413

Fig. 3.

Download original image
Fig. 3. Comparison of anti-repeat sequences of strains. 56% of strains had “acucaaucgaaauacucauugauuugauacucugag” anti-repeat sequence. The pairwise identity of sequences is 56.2%.
Korean J. Microbiol. 2021;57:12-22 https://doi.org/10.7845/kjm.2021.0093
© 2021 Korean J. Microbiol.