Korean Journal of Microbiology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2383-9902   pISSN 0440-2413

Table. 1.

Table. 1.

Primers used to sequence the complete genome of the Cherry virus A isolate DG-FC9

Primer name Oligonucleotide sequence (5' to 3') Amplicon size
CVA-JR-F1 CTTCCACCAATTTCCAAACAC 1,242 bp
CVA-JR-R1 AGATTGAATGATCCAAGAGTCA
CVA-JR-F2 GAATCATCCTTGGCCAAGCT 1,245 bp
CVA-JR-R2 ACCCAAATGA ATTGGAGCAC T
CVA-JR-F3 GTCCCTGAAGTTGGACCTC 1,245 bp
CVA-JR-R3 CAATTGGAAT GGATTCAGTT TAT
CVA-JR-F4 AAGATTTCCAATTCATTCAAATGT 1,245 bp
CVA-JR-R4 GAGTATTCAT GATTTTCTGG CA
CVA-JR-F5 AGTATGATGTTAGAAAGACTCAT 1,153 bp
CVA-JR-R5 TGTAACACAT ATGATGATTG CC
CVA-JR-F6 ATGAAGTTGAGCTGGAGGCT 1,158 bp
CVA-JR-R6 CCATGCCTTCACATTTGTGG
Primer name Oligonucleotide sequence (5' to 3')
5' RACE CVA-5'-R2 AGAGGAGATGGTTTTCAACGA
CVA-5'-R1 AGGACCTCAAAGCGGTTATG
3' RACE CVA-3'-F1 CTTGACTGCCAGAGCAACTA
CVA-3'-F2 TTCATCACCGTCACCAATCAA
Korean J. Microbiol. 2022;58:58-60 https://doi.org/10.7845/kjm.2022.2015
© 2022 Korean J. Microbiol.