Korean Journal of Microbiology

Table. 1.

Strains, plasmids and primers used in this study
Strains, plasmids or primers Genotype, relevant characteristics or sequence Source or reference
Strains
E. coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) Ф80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG Thermo Fisher Scientific
E. coli BL21(DE3) F- ompT hsdSB(rB- mB-) gal dcm lon λ(DE3), carrying T7 RNA polymerase gene Novagen
Plasmids
pGEM-T Easy pUC ori, Ampr, TA cloning vector, Promega
pET-22b(+) T7lac promoter, pBR322 ori, Ampr, parental expression vector Novagen
pET-RvCA1~pET-RvCA6 Expression plasmid carrying RvCA gene This study
pET-NEXT-RvCA1~pET-NEXT-RvCA6 Expression plasmid carrying NEXT-RvCA gene This study
Primersa
RvCA1 Forward: CCATGGGCTGGTTCAAGTTTCAGGGTG This study
Reverse: CTCGAGTTGGCTAAAACGC
RvCA2 Forward: CCATGGGCAAGCTGAGCACCGC This study
Reverse: CTCGAGACCGTTACGC
RvCA3 Forward: CCATGGGCATCGAAATTCATCATGCGG This study
Reverse: CTCGAGCAGGCAAATGA
RvCA4 Forward: CCATGGCGGGTCGTTG This study
Reverse: CTCGAGCAGCTGGG
RvCA5 Forward: CCATGGGCTTCGAGGACAGCTGG This study
Reverse: CTCGAGGCTGGTAAATTTC
RvCA6 Forward: CCATGGGCCAGAACGTTAGCAACCTG This study
Reverse: CTCGAGCAGTTTAATCACG

a Restriction sites are underlined.

Korean J. Microbiol. 2023;59:204-13 https://doi.org/10.7845/kjm.2023.3071
© 2023 Korean J. Microbiol.