search for




 

Complete genome sequence of a novel soybean mosaic virus isolated from soybean seeds in Korea
Korean J. Microbiol. 2023;59(3):230-233
Published online September 30, 2023
© 2023 The Microbiological Society of Korea.

You-Seop Shin1, Tae-Seon Park1, Ji-Soo Park1, Dong-Joo Min1, Ye-Yeong Kim1, Sangmin Bak2, Su-Heon Lee3, Sang-Min Kim4, Bong-Chun Lee4, Won-Kyong Cho5, and Jin-Sung Hong1*

1Interdisciplinary Program in Smart Agriculture, Kangwon National University, Chuncheon 24341, Republic of Korea
2School of Applied Biosciences, Kyungpook National University, Daegu 41566, Republic of Korea
3Department of Plant Medicine, Kyungpook National University, Daegu 41566, Republic of Korea
4Crop Foundation Division, National Institute of Crop Science, Rural Development Administration, Wanju 55365, Republic of Korea
5College of Biotechnology and Bioengineering, Sungkyunkwan University, Suwon 16419, Republic of Korea
Correspondence to: *E-mail: jinsunghong@kangwon.ac.kr; Tel.: +82-33-250-6437; Fax: +82-33-259-5558
Received August 25, 2023; Revised September 8, 2023; Accepted September 12, 2023.
Abstract
Soybean mosaic virus (SMV), a member of the genus Potyvirus, primarily damages soybeans. Although most SMV strains do not infect Solanaceae plants, an SMV isolate obtained from soybean seeds (SMV-Gm) was confirmed to induce systemic infection in Nicotiana benthamiana. Its complete genome sequence was determined using reverse transcription (RT)-PCR and cloning, showing that it comprises 9588 nucleotides, with a GC content of 41.65% and a single large polyprotein, consistent with the typical SMV composition.
Keywords : SMV, complete genome, Nicotiana benthamiana, seed transmission
Body

Soybean (Glycine max) is one of the most extensively cultivated crops worldwide, contributing significantly to the global vegetable protein supply owing to its high protein content and nutritional value (Soni et al., 2023). Soybeans are damaged by many pathogens such as viruses, bacteria, oomycetes, molds, and nematodes (Whitham et al., 2016). Among them Soybean mosaic virus (SMV; Potyvirus, Potyviridae) is a plant RNA virus identified to cause mosaic symptoms in soybeans in 1915 (Cho and Goodman, 1979). It has since been acknowledged globally to inflict significant damage, primarily to soybean crops (Hajimorad et al., 2018). Its host range is confined to leguminous plants (Gao et al., 2015). Infected soybean leaves exhibit diverse symptoms, including severe mosaic patterns, necrosis, stunted growth, and chlorotic spots. Infected plant seeds can also display speckled patterns (Hajimorad et al., 2018). Typically, SMV is transmitted non-permanently through aphids or infected seeds (Hajimorad et al., 2018). Nicotiana benthamiana is widely used as an indicator plant owing to its susceptibility to various plant viruses (Goodin et al., 2008). In previous studies exploring SMV infection of N. benthamiana, researchers have observed numerous recombinations within SMV's P1 protein, and interactions between N. benthamiana proteins and SMV NIb proteins that influence infectivity have been observed (Jiang et al., 2017; Widyasari et al., 2023). This study aimed to provide genetic data for SMV transmitted from seeds and infecting N. benthamiana. SMV-Gm was isolated from soybean seeds and mechanically introduced into N. benthamiana. Mild mosaic symptoms appeared on the upper leaves starting at 14 days post-inoculation (dpi). Subsequently, total RNA was extracted and viral infection was validated by reverse transcription (RT)-PCR using SMV-specific primers. To study the entire genome of the newly identified isolate, eight primer sets (Table 1) were devised, generating eight amplicons by RT-PCR. Each amplicon was cloned into a TA cloning vector (pGEM-T Easy vector, Promega), and Macrogen’s Sanger method in ABI PRISM 3730XL Analyzer (96 capillary type) (Macrogen) was used for sequencing. The eight-segment sequences was assembled into a single strand and the asslembled complete genome sequence has been deposited in Genbank (accession No. LC761388). Virus resources have been deposited at KACC (CV230906-01). The genome size measured 9588 nucleotides (nt), exhibiting a GC content of 41.65%. Similar to previously reported SMV isolates, SMV-Gm features a single large polyprotein (nt 132-9335) encoding ten proteins that divided by nine proteolytic cleavage sites: protein 1 (P1, nt 132-1058), helper component protease (HC-Pro, nt 1059-2429), protein 3 (P3, nt 2420-3470), 6 kDa protein 1 (6K1, nt 3471-3626), cylindrical inclusion body (CI, nt 3627-5528), 6K2 (nt 5529-5687), nuclear inclusion protein a-viral genome-linked protein (NIa-VPg, nt 5688-6257), NIa-Pro (nt 6258-6986), nuclear inclusion protein b (Nib, nt 6987-8537), and coat protein (CP, nt 8538-9332). A BLASTn search of the complete SMV-Gm sequence using the National Center for Biotechnology Information database indicated the highest nucleotide homology (97.27%) with SMV-WS105 (GenBank accession No. FJ 640958) isolated from Korean wild soybeans. The isolated SMV genome was aligned with 20 SMV isolates using the ClustalW method of the MEGA7 program, and the phylogenetic tree was generated with 1,000 bootstrap replications. Uraria mosaic virus was used as an outgroup for the Potyvirus genus. Uraria mosaic virus was used as an outgroup for the Potyvirus genus. SMV-Gm belonged to the SMV-G7 group and was similar to SMVs isolated from Korea (SMV-WS105 and SMV-WS110) and Japan (SMV-Aa) (Fig. 1). In summary, SMV-Gm was successfully isolated via seed transmission, its infectivity in N. benthamiana was verified, and its complete nucleotide sequence was determined. This study provides foundational data on SMV seed transmission and adaptation to new hosts.

Fig. 1. Phylogenetic relationship of 20 SMV isolates based on complete genome sequences.
The phylogenetic tree was constructed using the MEGA7 program with the maximum likelihood method and 1,000 bootstrap replicates. Uraria mosaic virus (UMV) was used as an outgroup for the Potyvirus genus.

Primers used to sequence the complete genome of the Soybean mosaic virus isolate Gm
Primer Sequence (5’-3’) GC (%) Tm (°C) Size (bp)
SMV-1F AATTAAAACTCGTTATAAAGACAAC 24.0 56.0 1,246 bp
SMV-1R CTTAATGTGCTGCCGACATTG 47.6 59.4
SMV-2F GCAGCGGCAATAAGCCAAT 52.6 57.3 1,272 bp
SMV-2R CATTCTCTGTTGCACTTCACC 47.6 59.4
SMV-3F CAGAGTGAGATGAAATTCTAC 38.1 55.5 1,271 bp
SMV-3R GTGAGCTTCTTATCTTCATCA 38.1 55.5
SMV-4F ACAATGGGTGAGGATGTTAAA 38.1 55.5 1,251 bp
SMV-4R ACGAGACAATATGTTGGTTGA 38.1 55.5
SMV-5F TATGGCCTGCCAGTTACAACA 47.6 59.4 1,251 bp
SMV-5R ATTGTGGTAGACTCTTTGCCG 47.6 59.4
SMV-6F AAAGACATGATTGGGGAAGGT 42.9 57.4 1,269 bp
SMV-6R CACTGCCTTCTCAAAAGCT 47.4 55.2
SMV-7F CCAAGCCGCTTAAACAAAGAT 42.9 57.4 1,284 bp
SMV-7R AACATCTGTGTACAGCTTTCT 38.1 55.5
SMV-8F AAAGCACCATATATTGCAGAG 38.1 55.5 1,189 bp
dT(18)-BamHI AGCTGGATCCTTTTTTTTTTTTTTTTTT 21.4 85.4

적 요

포티바이러스 속에 속하는 대두 모자이크 바이러스(SMV)는 주로 대두에 피해를 준다. 대부분의 SMV 균주는 가지과 식물을 감염시키지 않지만, 콩 종자에서 얻은 SMV 분리주(SMV-Gm)는 Nicotiana benthamiana에서 전신 감염을 유도하는 것으로 확인되었다. 완전한 유전체 서열은 역전사(RT)-PCR 및 클로닝을 사용하여 결정되었으며, 이는 41.65%의 GC 함량 및 전형적인 SMV 구성과 일치하는 단일 대형 다단백질과 함께 9588개의 뉴클레오티드를 포함한다는 것을 보여준다.

Acknowledgments

This work was supported by Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ014983022023) Rural Development Administration, Repubilc of Korea and the research grant of Kangwon National University in 2022.

Conflict of Interest

There are no conflicts of interest to declare.

References
  1. Cho EK and Goodman RM. 1979. Strains of soybean mosaic virus: classification based on virulence in resistant soybean cultivars. Phytopathology 69, 467-470.
    CrossRef
  2. Gao L, Zhai R, Zhong YK, Karthikeyan A, Ren R, Zhang K, Li K, and Zhi HJ. 2015. Screening isolates of soybean mosaic virus for infectivity in a model plant, Nicotiana benthamiana. Plant Dis. 99, 442-446.
    Pubmed CrossRef
  3. Goodin MM, Zaitlin D, Naidu RA, and Lommel SA. 2008. Nicotiana benthamiana: its history and future as a model for plant-pathogen interactions. Mol. Plant Microbe Interact. 21, 1015-1026.
    Pubmed CrossRef
  4. Hajimorad MR, Domier LL, Tolin SA, Whitham SA, and Saghai Maroof MA. 2018. Soybean mosaic virus: a successful potyvirus with a wide distribution but restricted natural host range. Mol. Plant Pathol. 19, 1563-1579.
    Pubmed KoreaMed CrossRef
  5. Jiang H, Li K, Dou D, and Gai J. 2017. Characterization of a soybean mosaic virus variant causing different diseases in Glycine max and Nicotiana benthamiana. Archives of Virology 162, 549-553.
    Pubmed CrossRef
  6. Soni K, Frew R, and Kebede B. 2023. A review of conventional and rapid analytical techniques coupled with multivariate analysis for origin traceability of soybean. Crit. Rev. Food Sci. Nutr. 1-20.
    Pubmed CrossRef
  7. Whitham SA, Qi M, Innes RW, Ma W, Lopes-Caitar V, and Hewezi T. 2016. Molecular soybean-pathogen interactions. Annu. Rev. Phytopathol. 54, 443-468.
    Pubmed CrossRef
  8. Widyasari K, Bwalya J, and Kim KH. 2023. Binding immunoglobulin 2 functions as a proviral factor for potyvirus infections in Nicotiana benthamiana. Mol. Plant Pathol. 24, 179-187.
    Pubmed KoreaMed CrossRef


December 2023, 59 (4)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information

Funding Information