search for




 

First isolation report and molecular phylogenetic characteristics of Raphidiopsis raciborskii in South Korea
Korean J. Microbiol. 2019;55(4):350-359
Published online December 31, 2019
© 2019 The Microbiological Society of Korea.

Ju-Yong Jeong1†*, Sang-Hoon Lee2†, Mi-Ra Yun1, Seung-Eun Oh1, Ji-Soo Kim1, Hee-Cheon Moon1, Chan-Won Hwang1,and Hee-Deung Park2*

1Department of Water Environment Research, Gyeonggi-do Institute of Health and Environment, Suwon 16205, Republic of Korea
2School of Civil, Environmental and Architectural Engineering, Korea University, Seoul 02841, Republic of Korea
Correspondence to: *(J.Y. Jeong) E-mail: jjy1014@gmail.com;
Tel.: +82-31-250-2691; Fax: +82-31-250-2587 /
(H.D. Park) E-mail: heedeung@korea.ac.kr;
Tel.: +82-2-3290-4861; Fax: +82-2-928-7656

These authors contributed equally to this work.
Received August 12, 2019; Revised September 21, 2019; Accepted October 21, 2019.
Abstract

As a result of global warming, aquatic ecosystems undergo changes such as the increase in the occurrence of harmful algal bloom and the introduction of new alien species. Raphidiopsis raciborskii originated in the tropical eutrophic system, but now it has expanded to the temperate zone according to climate change and has been found in many areas, including China and Japan. This cyanobacterium is a kind of harmful algae that is likely to produce toxins and has never been isolated in Korea. In this study, molecular genetic analysis was performed using cpcBA-IGS, nifH, and 16S rRNA gene that can estimate geographical relationships as well as microscopic observation of R. raciborskii isolated from a reservoir in Incheon for the first time in South Korea. The isolate was characterized by heterocyst that was responsible for nitrogen fixation at the ends of straight trichome. It was identified as R. raciborskii according to the morphology of the apical cell and akinete. Molecular genetic analysis of cpcBA-IGS and nifH showed that there is a closer relationship with the strains isolated in Asia, Europe, Australia, and Africa. R. raciborskii is highly likely to be distributed nationwide because straight, and S-shaped individuals were also observed in reservoirs in Incheon, Uiwang, and Hwaseong. In addition, since strains that produce toxins are found in Asia, and Australia, it is necessary to study their ecological characteristics along with nationwide distribution survey.

Keywords : Raphidiopsis raciborskii, cpcBA-IGS, nifH, 16S rRNA gene, harmful algae
Body

Raphidiopsis raciborskii (Woloszynska) Aguilera, Berrendero Gómez, Kastovsky, Echenique & Salerno는 최초 Anabaena 속으로 보고되었으며(Woloszynska, 1912), 분류법의 발전에 따라 Anabaenopsis, 그리고 Raphidiopsis (Cylindrospermopsis) 속으로 분류체계가 변화되어 알려져 왔다(Padisák, 1997; Komárek and Komárková-Legnerová, 2003; Aguilera et al., 2018). R. raciborskii는 국내에서 보고된 적이 없는 미기록 유해 남조류로, 1899년에 인도네시아 자바에서 처음으로 관찰된 바 있다(Woloszynska, 1912). 또한, R. raciborskii는 전 지구적 기후변화 등의 환경요인(Kokociński et al., 2017) 및 종 자체의 환경 적응력(Soares et al., 2013)으로 인해 점차 전 세계로 분포 영역을 확장하였다(Padisák, 1997; Antunes et al., 2015). 현재는 대부분의 대륙 및 중국, 일본을 포함한 아시아 등 여러 국가에서도 관찰되고 있는 것으로 보고되고 있으며, 1935년과 1995년에 각각 일본과 중국에서 분포가 관찰된 바 있다(Wilk-Woźniak et al., 2016). 이렇듯 가까운 주변국가에서 비교적 이른 시기에 발견되었다는 점에서 국내에도 최초 현미경 관찰을 통해 분포가 보고된 2017년보다 훨씬 이전에 전파되었을 것으로 추정된다(경기도보건환경연구원 물환경연구부, 2019).

R. raciborskii는 자연 환경에서 안정적으로 유지되는 사상체(trichome)의 말단세포(apical cell), 이형세포(heterocyst), 휴면포자(akinete) 등의 형태적 특징을 바탕으로 동정이 가능한 것으로 알려져 있다(Komárek and Kling, 1991; Saker and Neilan, 2001). 하지만 R. raciborskii은 환경변화에 따라 형태가 변할 수 있으며, 형태가 다른 경우에도 분자유전학적으로 매우 유사해서 종의 구분이 어려운 경우가 많다(Saker et al., 1999; Chonudomkul et al., 2004).

각 대륙에서 발견된 R. raciborskii의 분자유전학적 연관성과 이동경로에 대한 여러 선행연구들이 수행된 바 있으며, 이에 대한 몇 가지 가설이 제시된 바 있지만 아직까지 논란이 지속되고 있다(Antunes et al., 2015; Wilk-Woźniak et al., 2016). 최근 Moreira (2011) 연구진의 연구결과에 의하면, 아시아를 포함한 다섯 대륙에서 관찰된 R. raciborskii 종들을 대상으로 4개 유전자(16S rRNA, ITS longer spacer, ITS shorter spacer, rpoC1)를 이용한 분자계통학적 연구를 통해, R. raciborskii는 발견되는 대륙 별로 (1) 유럽, (2) 아프리카․아메리카, (3) 아시아․호주의 세 개의 그룹으로 분류될 수 있으며, 아시아․호주 그룹은 아프리카․아메리카 그룹에 비해, 유럽에서 발견된 종들과 보다 가까운 유연관계를 형성하고 있는 것으로 알려져 있다(Moreira et al., 2011). 이들의 분포 연구가 주목받고 있는 이유는 R. raciborskii가 조류독소를 생성하는 유해 남조류로 알려져 있기 때문이다. 특히 아시아 국가들 중 일본(Zarenezhad et al., 2012), 태국(Chonudomkul et al., 2004; Zarenezhad et al., 2012), 중국(Lei et al., 2014), 그리고 오세아니아의 호주(Saker et al., 1999; Schembri et al., 2001) 및 뉴질랜드(Wood and Stirling, 2003)에서 관찰되는 종들은 간 독소인 cylindrospermopsin을 생산하는 것으로 보고된 바 있다. 또한, 남미의 브라질에서 관찰되는 R. raciborskii 종들은 신경독소인 paralytic shellfish-poisoning (PSP)를 생산할 수 있다고 알려져 있다(Lagos et al., 1999). Griffiths과 Saker (2003)의 연구에 의하면, 1979년 호주 퀸즐랜드(Queensland)의 Palm island에서 R. raciborskii 종에 의해 생산된 cylindrospermopsin에 의해 148명의 탈수 및 설사 환자가 발생하였던 것으로 보고된 바 있다.

R. raciborskii은 국외에서 유입된 외래종으로, 일본이나 중국에서 관찰되는 동일 종들은 조류 독소를 생산할 수 있는 것으로 알려져 있다(Zarenezhad et al., 2012). 또한, 지구온난화와 같은 환경변화에 의해 국내 수계에서도 발생하는 것으로 알려져 있으며, 국외 사례와 같이 조류 독소 등으로 인한 피해를 유발할 가능성이 있다. 특히, 2012년 수행된 낙동강 수계 내 남조류 유전자 분석 연구 결과, 비록 현미경을 통해 확인되지는 않았지만, 낙동강 수계 내에서 Raphidiopsis (Cylindrospermopsis) 종이 소수이지만 유전자 단계에서의 검출되었던 사례가 보고된 바 있다(국립환경과학원 낙동강물환경연구소. 2013). 본 연구를 통해 동정 된 R. raciborskii GIHE 2018는 2017년 인천 남동구 소재의 해오름 공원 내 저수지의 과산화수소를 이용한 조류 제거 사업 제거효율 평가 과정에서 최초 현미경 관찰을 통해 발견된 남조류이며, 같은 해 경기도보건환경연구원에서 실시한 경기도 내 중점관리 저수지 서식중인 식물플랑크톤 조사 과정 중 의왕 소재의 왕송 저수지 및 화성시 소재 저수지 내에서도 관찰된 바 있다(경기도보건환경연구원 물환경연구부, 2019). 이를 통해, 현재 R. raciborskii가 국내에서 전국적인 분포를 보이고 있을 것으로 추정되고 있다.

본 연구의 목적은 일차적으로 국내 수계에서 최초로 관찰된 R. raciborskii를 현미경 관찰을 통해 분리, 순수배양(unialgal culture)하는 것이다. 이후 분리한 균의 정확한 종 동정을 위해 배양 과정의 형태적 특성을 모니터링 하는 것이다. 더불어 3가지 종류(16S rRNA, cpcBA-IGS, 그리고 nifH)의 유전자를 대상으로 계통분류학적 분석을 통해 순수 분리한 남조류의 분자유전학적 분류체계 분석 및 분자계통학적 특성을 규명하는 것이다.

재료 및 방법

현장 특성 및 개체관찰

2018년 8월 인천 남동구 소재의 해오름공원 내 저수지(37.38 N 126.72 E)로부터 표층수 시료를 채취하였다. 저수지는 간척지에 인공적으로 조성되어 있었으며, 290 m × 170 m 크기의 직사각형 형태로 수심은 약 1.5 m, 저수용량은 60,000 t이었다. 채취된 시료로부터 사상체 말단에 위치한 이형세포가 특징인 R. raciborskii를 위상차 현미경(Carl Zeiss)을 통해 관찰하였다.

분리․배양 및 분자유전학적 분석

R. raciborskii 균주의 분리․배양을 위해, 현미경(Axiotop2 plus)으로 관찰하면서, 마이크로 피펫을 이용하여 R. raciborskii의 사상체를 분리, Jaworski’s (JM, Thompson et al., 1988) 배지(기산바이오)에 접종한 후, 27°C에서 광주기(day:night) 16:8의 조건으로 배양하였다. 순수배양을 위해, 증식이 관찰된 배양용기로부터 배양체를 수시로 분리하여, 새로운 배지에 접종하는 과정을 반복 수행하였다. 현미경 관찰을 통해 충분한 개체수의 순수배양체가 확인된 경우, 원심분리기를 이용하여 1000 rpm에서 20분간 배양체를 농축하였으며, xanthogenate- sodium dodecyl sulfate 완충액(Tillett and Neilan, 2000)를 이용하여 genomic DNA를 추출하였다. 간략하게, 성장 중기에서 후기 사이의 배양체 1 ml를 원심분리하여 cell pellet을 형성시킨 후, 50 ml의 TER (10 mM Tris-HCl, pH 7.4; 1 mM EDTA, pH 8; 100 µg/ml of RNase A) 용액을 첨가하여 pellet을 재부유한다. 재부유된 세포들을 1.5-ml microcentrifuge 튜브에 나누어 담은 후, 750 ul의 바로 제작된 XS buffer (1% potassium ethyl xanthogenate [Fluka]; 100 mM Tris-HCl, pH 7.4; 20 mM EDTA, pH 8; 1% sodium dodecylsulfate; 800 mM ammonium acetate)를 첨가하여 약하게 혼합하였다. 혼합액의 상태 변화에 따라 혼합액이 담긴 튜브를 70oC 온도 조건에서 10분에서 120분간 배양한다. 이후, 튜브를 10초간 강하게 혼합한 후, 30분간 ice 상에서 배양한다. 원심분리 과정(14,000 rpm에서 10분간)을 통해 cell 부산물을 제거한 후, 750 ul의 이소프로필알코올이 첨가된 새로운 튜브에 상등액을 옮긴다. 이후, 상온에서 10분간 배양한 후, 원심분리 과정(12,000 × g에서 10분간)을 통해 DNA를 침전시킨다. 추출된 DNA은 70% 에틸알코올로 1회 세척하고, 건조한 후, 최종적으로 100 ml의 TE 용액(10 mM Tris-HCl, pH 7.4; 1 mM EDTA, pH 8)을 첨가하여 추출한다. 추출된 DNA는 NanoDrop 2100 spectrophotometer (Thermo Fisher Scientific, WI)을 이용해 농도를 정량하였다.

피코시아닌 유전자(cpcBA-IGS), 질소고정 유전자(nifH, Denitrogenase reductase) 및 16S rRNA 유전자는 Table 1에 제시된 프라이머(primer) 조합을 사용하여 증폭되었으며, 각 primer 별 PCR 증폭을 위한 온도 및 시간 조건은 다음과 같다. cpcBA-IGS primer의 경우, 95oC에서 5분간 초기 denaturation을 수행하였으며, 이후, 95oC에서 30초간 denaturation, 56oC에서 30초간 annealing, 72oC에서 1분간 extension을 30회 반복 수행하였다. nifH primer의 경우, 95oC에서 3분간 초기 denaturation을 수행하였으며, 이후 95oC에서 30초간 denaturation, 53oC에서 30초간 annealing, 72oC에서 30초간 extension을 30회 반복 수행하였다. 마지막으로 16S rRNA 유전자 primer의 경우, 95oC에서 3분간 초기 denaturation을 수행하였으며, 이후 95oC에서 30초간 denaturation, 53oC에서 30초간 annealing, 72oC에서 30초간 extension을 30회 반복 수행하였다. PCR 증폭의 최종 단계에서, 72oC에서 5분간 최종 extension 과정을 수행하였다. PCR 산물들은 agarose gel을 이용한 전기영동을 통해 확인하였으며, 이후 염기서열 분석에 사용되었다(Macrogen).

Primers used in this study

Target geneNameProduct size (bp)Sequence (5' to 3')Annealing Temp. (°C)References
cpcBA-IGS CyanobacteriaPCbF685GGCTGCTTGTTTACGCGACA56Neilan et al. (1995)
PCaRCCAGTACCACCAGCAACTAA
Nitrogenase reductasenifHF382CGTAGGTTGCGACCCTAAGGCTGA53Gugger et al. (2005)
nifHRGCATACATCGCCATCATTTCACC
16S rRNA gene27F1489AGAGTTTGATCCTGGCTCAG60Neilan et al. (1997),
1516FATCCAGCCACACCTTCCGGYilmaz et al. (2008)

확보된 염기서열은 Blastn 소프트웨어(Altschul et al., 1997)를 이용하여 NCBI 데이터베이스(http://www.ncbi.nlm.nih.gov/taxonomy)의 유사 유전자와 염기서열이 일치도를 비교하여 동정하였다. 계통수 분석은, ClustalW (Thompson et al., 1994)로 multiple alignment를 수행한 후, MegaX 프로그램(Kumar et al., 2018)을 이용하여 유전자 별 최적의 모델을 선별한 후, maximum likelihood 분석 방법을 적용하여 계통수를 작성하였다.

결과 및 고찰

형태적 특성을 통한 종 동정

본 연구에서는 인천지역 저수지로부터 국내 최초로 분포가 발견된 R. raciborskii의 정확한 동정을 위해, 위상차 현미경을 통한 형태적 특징 관찰과 함께, 분자유전학적 분류법을 적용하여 동정 연구를 수행하였다. 남조류 발생 시기인 8월의 수질은, 수온 28~30°C, TOC 13.1~23.9 mg/L, 탁도 27.6~42.3 NTU, TN 1.811~3.258 mg/L, TP 0.058~0.133 mg/L, 클로로필a 19.8~ 333.0 mg/m3으로 변화가 매우 큰 것으로 관찰되었으며, 시료의 색도는 연황색을 띄며 R. raciborskii가 4.5 × 104~1.8 × 105 cells/ml의 비교적 높은 밀도로 관찰되었다.

R. raciborskii는 사상체가 직선형(straight), S자형(sigmoid) 및 나선형(coil) 등 세 가지의 형태를 보인다고 알려져 있지만(Komárek and Komárková-Legnerová, 2003), 본 연구에서는 S자형과 직선형의 사상체만이 관찰되었다. 분리․배양된 사상체는 직선형으로 단독으로 존재하고 초(Sheath)가 없으며 양끝 쪽으로 갈수록 약간 가늘어져서 말단의 세포는 둥근 원뿔 형태로 관찰되었다. 영양세포의 길이 및 두께는 각각 10.16 ± 1.64 µm 및 2.60 ± 0.22 µm로 관찰되었으며, 이형세포의 경우 길이 및 두께가 각각 6.21 ± 1.25 µm 및 2.68 ± 0.38 µm로 관찰되었다. 이와 함께, 휴면포자의 경우 길이 10.45 ± 2.97 µm 및 두께 4.10 ± 0.59 µm로 관찰되었다. R. raciborskii의 가장 두드러진 형태적 특징은 자연환경 내에서 질소고정을 담당하는 이형세포가 사상체의 말단에만 위치하는 것으로, 이를 통해 다른 남조류와 구별이 가능하다. 사상체의 말단에 위치하는 이형세포는 환경 내에서 사상체의 한쪽 말단에서만 관찰되지만, 배양과정에서는 배지 내 질소 성분이 풍족할 경우 형성되지 않거나, 질소가 부족한 경우 양쪽 말단에서 모두 발달할 수 있다(John et al., 2011). 본 연구에서 분리 배양된 R. raciborskii의 경우, 자연상태에서는 한쪽에서만 이형세포가 관찰되었으며, 배양과정에서 이형세포의 생성을 유도하기 위해 사용된 질소원을 제거한 JM 배지를 사용하였다. 이로 인해, 배양된 R. raciborskii 사상체의 한쪽 혹은 양쪽에서 이형세포가 형성된 것으로 추정된다. John 등 (2011)도 유사한 조건에서 이형세포를 관찰하였다.

조류 독소를 분비할 수 있는 것으로 알려진 R. raciborskii는 형태적으로 가장 유사한 종인 R. africana와 휴면포자(akinete) 및 사상체 말단 세포의 형태적 특징으로 구별이 가능하다. 휴면포자의 관찰을 위해 R. raciborskii 배양체를 낮은 온도(12°C)로 옮겨 휴면포자의 발생을 유도할 수도 있지만(Li et al., 1997), 본 연구를 통해 배양기간이 2개월 이상으로 길어지면 조류의 사멸이 관찰되고 휴면포자가 자연적으로 발달할 수 있다는 것이 확인되었다. R. raciborskii의 휴면포자는 원통형 혹은 긴 타원형(cylindrical or oval)의 형태를 보이지만, 말단 세포는 둥근 원뿔 형태(apical cells rounded-conical at the ends)를 형성한다. 반면, R. africana의 경우는 휴면포자가 타원형(ellipsoidal)이며 말단세포는 둥근 형태(apical cells rounded at the ends)를 형성하는 것으로 보고된 바 있다(Komárek and Kling, 1991). Figure 1A는 시료채취 당시 자연상태의 세포 형태를 나타낸다. Figure 1B는 이형세포가 없는 둥근 원뿔 형태의 말단 세포를 나타내며, Fig. 1C는 사상체 한쪽 말단에만 이형세포가 있는 개체를 나타낸다. 이와 함께, Fig. 1D는 사상체 양쪽 말단에 이형세포가 있는 개체를, Fig. 1E는 양쪽 말단에 이형세포가 있는 실린더 형태의 휴면포자가 발달한 개체와 타원형의 휴면포자를 나타낸다.

Fig. 1.

Phenotypic characteristics of Raphidiopsis raciborskii, (× 1000). (A) Vegetative cell in water sample; (B) without heterocyst of filament. Arrows indicate apical cells rounded-conical at the ends; (C) with heterocyst at one end of filament. Arrow indicates apical cells rounded-conical at the end; (D) with heterocysts at both ends of filament; (E) with an akinete and with heterocysts at the both ends of filament. Arrows indicate akinetes cylindrical to oval. Scale bars = 10 μm.


분자유전학적 분석을 통한 동정 및 지리적 연관성 추정

R. raciborskii는 분자유전학적 지표로서 cpcBA-IGS와 nifH 유전자의 염기서열 비교를 통해, 계통수 상에서 지리적 특성에 따른 분류가 가능한 것으로 알려져 있다(Dyble et al., 2002; Haande et al., 2008). 선행 연구의 결과들에 따르면, cpcBA- IGS 유전자는 아메리카 및 유럽․호주의 두 그룹으로 분류가 가능하며(Dyble et al., 2002), nifH 유전자는 유럽, 호주, 아메리카의 세 그룹으로 분류된 바 있다(Haande et al., 2008). 하지만 아직까지 아시아를 포함하여, 상기 두 종류의 유전자를 이용한 연구는 현재까지 보고된 바가 없다. 이번 연구에서는 국내에서 최초로 분리․배양된 R. raciborskii를 대상으로 cpcBA- IGS와 nifH 유전자 염기서열의 계통분석법을 적용하여, 유전자의 염기서열의 차이를 토대로 지리적 분포 특성을 비교 분석하는, 미생물 지리학(microbial geography) 분석 연구를 수행하였다.

연구 과정에서 순수배양 된 R. raciborskii GIHE 2018의 cpcBA-IGS 유전자 염기서열은 기존 문헌상에 보고된 R. raciborskii 종의 유전자 염기서열들과 ~99% 상동성을 보이는 것으로 관찰되었으며, 이들은 분자계통학적 분석결과 크게 2개의 그룹으로 관찰되었다(Fig. 2). 특히, 이번에 분리된 R. raciborskii 종의 cpcBC-IGS 유전자는 미국․남미에서 관찰된 개체들의 유전자 염기서열 보다, 중국․ 유럽․호주․아프리카에서 분리된 개체들의 유전자 염기서열과 보다 높은 유연관계를 형성하였다.

Fig. 2.

Molecular phylogenetic analysis by maximum likelihood method based on cpcBA-IGS with Anabaena bergii as the outgroup. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura 3-parameter model The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories [+ G, parameter = 0.1911]).


반면, 질소고정 기능을 보유한 모든 미생물에 존재하는 유전자인 nifH 유전자의 염기서열의 경우, 주로 uncultured bacterium clone의 유전자 염기서열과 99% 이상 유사하였다(Fig. 3). 안타깝게도, 본 연구 과정에서는 아시아에서 분리된 R. raciborskii 개체의 염기서열을 얻을 수 없어 직접적인 유연관계를 파악할 수 없었다. Figure 3에서와 같이 계통수는 세 개의 그룹으로 분리되었으며, 본 연구를 통해 분리된 R. raciborskii GIHE 2018의 nifH 유전자는 아프리카와 호주에서 분리된 종과 상대적으로 근접한 유연관계를 형성하였다. 또한, 미국․남미에서 분리된 개체의 nifH 유전자와는 확연하게 구분된 그룹을 형성하며, cpcBA-IGS 유전자와는 달리, 유럽 지역에서 분리된 개체의 유전자들보다 호주와 아프리카에서 분리된 개체들과 단일 그룹을 형성하는 것으로 관찰되었다. 이 결과는, R. raciborskii가 아프리카 → 호주 → 아시아 → 중부 유럽으로의 경로와, 남미 → 북미 → 지중해로의 2가지 경로를 통해서 전파되었을 것이라는 선행 연구결과(Panou et al., 2018)와 일치한다. 향후, 추가적인 연구를 통해 R. raciborskii GIHE 2018 및 아시아에서 분리 동정된 종들의 유전체(Whole genome sequence) 분석 과정을 통한 nifH 유전자의 변이를 관찰하는 연구가 필요할 것으로 사료된다.

Fig. 3.

Molecular phylogenetic analysis by maximum likelihood method based on nifH gene with Anabaena oscillarioides as the outgroup. The evolutionary history was inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach.


R. raciborskii GIHE 2018이 보유한 16S rRNA 유전자 염기서열은 기존 데이터베이스 내 보고된 R. raciborskii 종들의 16S rRNA 유전자와 ~99% 이상 상동성을 보였다(Fig. 4). 특이하게도, cpcBA-IGS 및 nifH 유전자와는 달리, 16S rRNA 유전자 염기서열의 경우 지역적인 분포 특성이 관찰되지는 않았다. 16S rRNA 유전자의 계통수 분석 결과, 모든 Raphidiopsis (Cylindrospermopsis) 속에 속하는 개체들이 분리된 지역과 관련 없이 단일 클러스터를 형성하는 것으로 관찰되었다(Fig. 4). 이를 통해, Raphidiopsis 속의 각 종들은 16S rRNA 유전자의 염기서열은 분리 동정된 지역과는 무관하게 서로 유사할 것으로 사료되며, 분포 지역별 상이한 종이 아닌 단일 종의 개체가 지역 이동을 통해 현재의 분포양상을 보이고 있을 것임을 암시하는 결과로 사료된다. 또한, cpcBA-IGS 및 nifH 유전자의 경우, 균주의 지역 이동 과정에서 지역 특이적 유전자 염기서열들이 유전자 수평이동을 통해 genome 내부로 유입되었을 가능성이 있음을 암시한다.

Fig. 4.

Molecular phylogenetic analysis by maximum likelihood method based on 16S rRNA gene with Anabaena circinalis as the outgroup. The evolutionary history was inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories [+ G, parameter = 0.0720]).


또한, Raphidiopsis (Cylindrospermopsis)는 형태적 특징을 기반으로 전통적으로 5개의 종으로 분류되지만, 박테리아의 종 판단 기준인 16S rRNA 유전자 염기서열 분석법(97% 염기서열 유사성) 혹은 DNA-DNA hybridization 분석법(70% 염기서열 유사성)을 적용한 분석에서 모두 같은 종으로 분류될 수 있다는 선행연구의 결과들과 상응하는 것으로 판단된다(Otsuka et al., 2001). 중국의 수계에서 분리된 Raphidiopsis (Cylindrospermopsis) 속에 속하는 6종(R. raciborskii, R. taverae, R. africana, R. helicoidea, R. philippinensis)의 16S rRNA 유전자는 99.2~100%의 높은 유사도를 보이는 것으로 관찰되었다. 하지만 분자계통학적 분석 결과에서는 이들이 서로 유사한 종으로 분류되었다. 또한, 선행연구를 통해, 16S rRNA, cpcBA-IGS, rpoC1, ITS-L의 4가지 유전자를 이용한 분석을 통해서도 앞서 언급된 6종의 분자계통학적 특성을 명확하게 구별하지 못한 바 있다(Li et al., 2017). 따라서, 이들 유전자 염기서열 분석법을 통해, R. raciborskii의 지리적 분포 특성에 대한 추론은 가능하지만, 종간의 분자계통학적 특성을 구분하기에는 한계가 있을 것으로 판단된다.

결론적으로, 본 연구를 통해, 국내에서 처음 발견된 남조류는 말단 세포와 휴면포자의 형태에 따라 R. raciborskii로 동정되었으며, cpcBA-IGS 및 nifH 유전자 염기서열을 이용한 분자유전학적 분석결과, 아시아․호주․아프리카 지역에서 분리된 개체들과의 유연관계가 상대적으로 높다는 결과를 관찰할 수 있었다.

결 론

본 연구를 통해, 인천지역의 저수지 시료로부터 휴면포자와 사상체 말단 세포의 형태 분석을 통해, 국내 수계로부터 처음으로 남조류인 R. raciborskii를 분리․배양 및 동정하였다. 본 연구를 통해 분리된 R. raciborskii는 사상체 말단에 존재하는 이형세포를 제외하고는 다른 남조류와 형태적으로 매우 유사하였다. cpcBA-IGS, nifH 유전자 염기서열을 이용한 분자계통학적 연구를 통해, 본 연구에서 관찰된 R. raciborskii가 중국에서 분리된 R. raciborskii와 염기서열이 매우 유사하며, 미국․남미에서 분리된 종 보다는 아시아․호주․아프리카에서 분리된 종과 상대적으로 높은 유연관계를 형성할 수 있다는 것이 관찰되었다. 반면, 16S rRNA 유전자 염기서열은 Raphidiopsis (Cylindrospermopsis) 속 내에서 서로 유사하여, 지역별 특성이 관찰되지는 않았다. 이를 통해, 국내에서 발견된 R. raciborskii는 아프리카와 호주를 거쳐 전파되었을 가능성이 있으며, 이들이 보유한 cpcBA-IGS 및 nifH 유전자는 지역 특이적 유전자의 유전자 수평이동을 통해 genome 내부로 유입되었을 것으로 사료되었다.

현재까지 국내에서 발견된 R. raciborskii 종은 수계 내에 소수의 개체만이 존재하기 때문에 미기록 종으로 남아있었을 것으로 추정된다. Raphidiopsis 속은 2012년 낙동강 수계 내 남조류 유전자 조사 과정에서 유전자 관찰을 통해 분포 가능성이 제기된 바는 있지만, 그 수가 매우 소수로 관찰되었으며, 실제 현미경 관찰을 통해 분포가 확인되지는 않았다. 2017년부터 수행된 남조류 분포 조사 과정에서 인천, 화성, 의왕 소재 저수지에서도 수온이 높은 8월 다양한 형태적 특성을 갖는 R. raciborskii가 관찰되었기 때문에, 이들이 중국의 경우와 유사하게 차후 높은 밀도로 전국적인 분포를 나타낼 가능성이 있다. 또한, 선행 연구 결과, 중국, 일본, 호주 지역에서 분리된 R. raciborskii 종들이 조류 독소를 생산한다는 연구 결과가 보고된 바 있기 때문에, 분자유전학적으로 매우 유사한 국내 종 역시 독소를 생산할 가능성이 클 것으로 추정된다. 따라서, 국내에서도 R. raciborskii의 전국적인 분포 조사가 수행되어야 할 것으로 사료되며, 국내에서 발견된 R. raciborskii를 유해남조류로 추가 지정하여 체계적인 관리가 필요할 것으로 판단된다.

적 요

온난화에 의한 수 생태계는 유해 조류의 발생이 증가되고 새로운 외래종이 유입되는 등 변화를 겪고 있다. R. raciborskii는 열대지방의 부영양 수계에서 기원하였지만 기후변화 등 환경요인에 따라 현재 온대지역까지 그 분포 영역을 확장하여 중국과 일본을 포함한 많은 지역에서 발견되고 있다. 이 남조류는 독소를 생산할 가능성이 있는 유해 조류의 일종으로, 현재까지 국내에서는 발견이 보고된 바가 없었다. 본 연구에서는 국내 최초로 인천지역의 저수지에서 분리된 R. raciborskii를 대상으로 종 분리 배양 및 동정을 위해 현미경을 이용한 형태관찰 및 cpcBA-IGS, nifH, 그리고 16S rRNA 유전자를 이용하여 지리적 연관성을 추정할 수 있는 분자유전학적 분석을 수행하였다. 분리된 균주는 직선형의 사상체로, 말단에 질소고정을 담당하는 이형세포의 위치가 특징이며, 말단세포와 휴면포자의 형태에 따라 R. raciborskii로 동정되었다. 이와 함께, cpcBA-IGS, 그리고 nifH 유전자를 이용한 분자유전학적 분석결과 아시아, 유럽, 호주, 아프리카에서 분리된 개체와 밀접한 유연관계를 형성하는 것으로 관찰되었다. 반면, 16S rRNA 유전자의 계통학적 분석 결과에서는 지역별 분포 특성이 관찰되지 않았다. 2017년 이후 인천, 의왕, 화성에서 직선형 및 S자 형태의 R. raciborskii가 관찰되면서, 전국적으로 광범위한 분포를 보일 가능성이 매우 높을 것으로 추정되며, 아시아와 호주에서 독소를 생산하는 종이 발견되고 있기 때문에 전국적인 분포조사 및 생태학적 특성에 대한 연구가 필요할 것으로 사료된다.

감사의 말

본 연구는 국립환경과학원의 시도보건환경연구원 국고보조사업의 일환으로 진행되었으며 이에 깊이 감사 드립니다.

References
  1. Aguilera A, Gómez EB, Kaštovský J, Echenique , RO , and Salerno GL. 2018. The polyphasic analysis of two native Raphidiopsis isolates supports the unification of the genera Raphidiopsis and Cylindrospermopsis (Nostocales, Cyanobacteria). Phycologia. 57, 130-146.
    CrossRef
  2. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, and Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.
    Pubmed KoreaMed CrossRef
  3. Antunes JT, Leão PN, and Vasconcelos VM. 2015. Cylindrospermopsis raciborskii: review of the distribution, phylogeography, and ecophysiology of a global invasive species. Front. Microbiol. 6, 473..
    Pubmed KoreaMed CrossRef
  4. Chonudomkul D, Yongmanitchai W, Theeragool G, Kawachi M, Kasai F, Kaya K, and Watanabe MM. 2004. Morphology, genetic diversity, temperature tolerance and toxicity of Cylindrospermopsis raciborskii (Nostocales, Cyanobacteria) strains from Thailand and Japan. FEMS Microbiol Ecol. 48, 345-355.
    Pubmed CrossRef
  5. Dyble J, Paerl HW, and Neilan BA. 2002. Genetic characterization of Cylindrospermopsis raciborskii (cyanobacteria) isolates from diverse geographic origins based on nifH and cpcBA-IGS nucleotide sequence analysis. Appl. Environ. Microbiol. 68, 2567-2571.
    Pubmed KoreaMed CrossRef
  6. Gugger M, Molica R, Le Berre B, Dufour P, Bernard C, and Humbert JF. 2005. Genetic diversity of Cylindrospermopsis strains (cyanobacteria) isolated from four continents. Appl. Environ. Microbiol. 71, 1097-1100.
    Pubmed KoreaMed CrossRef
  7. Griffiths DJ, and Saker ML. 2003. The Palm Island mystery disease 20 years on: a review of research on the cyanotoxin cylindrospermopsin. Environ. Toxicol. 18, 78-93.
    Pubmed CrossRef
  8. Haande S, Rohrlack T, Ballot A, Røberg K, Skulberg R, Beck M, and Wiedner C. 2008. Genetic characterisation of Cylindrospermopsis raciborskii (Nostocales, Cyanobacteria) isolates from Africa and Europe. Harmful Algae. 7, 692-701.
    CrossRef
  9. John DM, Whitton BA, and Brook AJ. 2011. The freshwater algal flora of the british isles: An identification guide to freshwater and terrestrial algae, , 2nd edn. Cambridge University Press, Cambridge .
  10. Kokociński M, Gągała I, Jasser I, Karosienė J, Kasperovičienė J, Kobos J, Koreivienė J, Soininen J, Szczurowska A, and Woszczyk M, et al. 2017. Distribution of invasive Cylindrospermopsis raciborskii in the East-Central Europe is driven by climatic and local environmental variables. FEMS Microbiol. Ecol. 93, fix035..
    Pubmed CrossRef
  11. Komárek J, and Kling H. 1991. Variation in six planktonic cyanophyte genera in Lake Victoria (East Africa). Arch. Hydrobiol. 61, 21-45.
  12. Komárek J, and Komárková-Legnerová J. 2003. Phenotype diversity of the cyanoprokaryotic genus Cylindrospermopsis (Nostocales). Czech Phycol. 3, 1-30.
  13. Kumar S, Stecher G, Li M, Knyaz C, Tamura , and K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547-1549.
    Pubmed KoreaMed CrossRef
  14. Lagos N, Onodera H, Zagatto PA, Andrinolo D, Azevedo SM, and Oshima Y. 1999. The first evidence of paralytic shellfish toxins in the fresh water cyanobacterium Cylindrospermopsis raciborskii, isolated from Brazil. Toxicon. 37, 1359-1373.
    Pubmed CrossRef
  15. Lei L, Peng L, Huang X, Han , and BP. 2014. Occurrence and dominance of Cylindrospermopsis raciborskii and dissolved cylindrospermopsin in urban reservoirs used for drinking water supply, South China. Environ. Monit. Assess. 186, 3079-3090.
    Pubmed CrossRef
  16. Li R, Watanabe M, and Watanabe MM. 1997. Akinete formation in planktonic Anabaena spp. (cyanobacteria) by treatment with low temperature. J. Phycol. 33, 576-584.
    CrossRef
  17. Li XC, Huo SL, Cai FF, Yang YM, Xi BD, and Li RH. 2017. The taxonomy and phylogeny of the genus Cylindrospermopsis (Cyanobacterium) evaluated by adding five new records from China. Phytotaxa. 316, 224-238.
    CrossRef
  18. Moreira C, Fathalli A, Vasconcelos V, and Antunes A. 2011. Genetic diversity and structure of the invasive toxic cyanobacterium Cylindrospermopsis raciborskii. Curr. Microbiol. 62, 1590-1595.
    Pubmed CrossRef
  19. Nakdong River Environment Research Institute, National Institute of Environmental Research. 2013. Analysis of cyanobacteria on the Nakdong River by Molecular based analysis. Republic of Korea.
  20. Neilan BA, Jacobs D, Goodman , and AE. 1995. Genetic diversity and phylogeny of toxic cyanobacteria determined by DNA polymorphisms within the phycocyanin locus. Appl. Environ. Microbiol. 61, 3875-3883.
    Pubmed KoreaMed CrossRef
  21. Neilan BA, Jacobs D, Del Dot T, Blackall LL, Hawkins PR, Cox PT, Goodman , and AE. 1997. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 47, 693-697.
    Pubmed CrossRef
  22. Otsuka S, Suda S, Shibata S, Oyaizu H, Matsumoto S, and Watanabe MM. 2001. A proposal for the unification of five species of the cyanobacterial genus Microcystis Kützing ex Lemmermann 1907 under the rules of the Bacteriological Code. Int. J. Syst. Evol. Microbiol. 51, 873-879.
    Pubmed CrossRef
  23. Padisák J. 1997. Cylindrospermopsis raciborskii (Woloszynska) Seenayya et Subba Raju, an expanding, highly adaptive cyanobacterium: worldwide distribution and review of its ecology. Arch. Hydrobiol. 107, 563-593.
  24. Panou M, Zervou SK, Kaloudis T, Hiskia A, and Gkelis S. 2018. A Greek Cylindrospermopsis raciborskii strain: Missing link in tropic invader's phylogeography tale. Harmful Algae. 80, 96-106.
    Pubmed CrossRef
  25. Saker ML, Neilan BA, and Griffiths DJ. 1999. Two morphological forms of Cylindrospermopsis raciborskii (cyanobacteria) isolated from Solomon Dam, Palm Island, Queensland. J. Phycol. 35, 599-606.
    CrossRef
  26. Saker ML, and Neilan BA. 2001. Varied diazotrophies, morphologies, and toxicities of genetically similar isolates of Cylindrospermopsis raciborskii (nostocales, cyanophyceae) from Northern Australia. Appl. Environ. Microbiol. 67, 1839-1845.
    Pubmed KoreaMed CrossRef
  27. Schembri MA, Neilan BA, and Saint CP. 2001. Identification of genes implicated in toxin production in the cyanobacterium Cylindrospermopsis raciborskii. Environ. Toxicol, 413-421.
    Pubmed CrossRef
  28. Soares MCS, Lürling M, and Huszar VLM. 2013. Growth and temperature-related phenotypic plasticity in the cyanobacterium Cylindrospermopsis raciborskii. Phycol. Res. 61, 61-67.
    CrossRef
  29. Tillett D, and Neilan BA. 2000. Xanthogenate nucleic acid isolation from cultured and environmental cyanobacteria. J. Phycol. 36, 251-258.
    CrossRef
  30. Thompson JD, Higgins DG, and Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680.
    Pubmed KoreaMed CrossRef
  31. Thompson AS, Rhodes JC, and Pettman I. 1988. Natural environmental research council culture collection of algae and protozoa, pp. 22, Catalogue of strains. Ambleside: Freshwater Biology Association, UK .
  32. Water Environment Research Department, Gyeonggi-do Institute of Health and Environment. 2019. Research report of major reservoir phytoplanktons in Gyeonggi-do 2018. Republic of Korea.
  33. Wilk-Woźniak E, Solarz W, Najberek K, and Pociecha A. 2016. Alien cyanobacteria: an unsolved part of the "expansion and evolution" jigsaw puzzle?. Hydrobiologia. 764, 65-79.
    CrossRef
  34. Woloszynska J. 1912. Das Phytoplankton einiger javanischer Seen, mit Berucksichtigung des Sawa-Planktons. Bull. Acad. Sci. Cracovie, mat.-nat. ser. B. 6, 649-709.
  35. Wood SA, and Stirling DJ. 2003. First identification of the cylindrospermopsin‐producing cyanobacterium Cylindrospermopsis raciborskii in New Zealand. New Zeal. J. Mar. Fresh. 37, 821-828.
    CrossRef
  36. Yilmaz M, Phlips EJ, Szabo NJ, and Badylak S. 2008. A comparative study of Florida strains of Cylindrospermopsis and Aphanizomenon for cylindrospermopsin production. Toxicon. 51, 130-139.
    Pubmed CrossRef
  37. Zarenezhad S, Sano T, Watanabe MM, and Kawachi M. 2012. Evidence of the existence of a toxic form of Cylindrospermopsis raciborskii (nostocales, cyanobacteria) in Japan. Phycol. Res. 60, 98-104.
    CrossRef


December 2019, 55 (4)