search for




 

CRISPR/Cas systems and anti-repeat sequences of Lactobacillus curvatus, Lactobacillus graminis, Lactobacillus fuchuensis, and Lactobacillus sakei genomes
Korean J. Microbiol. 2021;57(1):12-22
Published online March 31, 2021
© 2021 The Microbiological Society of Korea.

Özge Kahraman Ilıkkan*

Food Quality Control and Analysis Program, Kahramankazan Vocational School, Başkent University, Ankara 06980, Turkey
Correspondence to: E-mail: okilikkan@baskent.edu.tr;
Tel.: +90-312-8141919; Fax: +90-312-8143737
Received September 21, 2020; Revised January 26, 2021; Accepted February 22, 2021.
Abstract
CRISPR/Cas system (Clustered regularly interspaced short palindromic repeats–CRISPR associated genes) helps the bacteria or the archaea to gain immunity against phage or plasmid invasions. Lactobacillus curvatus has been known to be phylogenetically related to Lactobacillus fuchuensis, Lactobacillus graminis, and Lactobacillus sakei. In this study, this relationship has been investigated in terms of CRISPR/Cas systems, Cas1, Cas2 amino acid sequences, protospacers, and anti-repeat sequences. A total of 54 genomes (34 whole-genome and 20 draft genome) were investigated, 25 genomes had CRISPR/Cas system, namely, 23 type II-A, 2 II-C, and 2 I-E. The pairwise identity of anti-repeat sequences was 77.4%. Phylogeny analysis and alignment of Cas1 and Cas2 amino acid sequences were carried out to evaluate the relationship among CRISPR subtypes and four species. The phylogenetic tree tended to split into branches corresponding to the CRISPR/Cas subtype II-A, II-C, and I-E. According to protospacer analysis, common invaders of strains were Pediococcus damnosus, Pediococcus claussenii, Lactobacillus brevis, Lactobacillus backii, Lactobacillus plantarum, and Lactobacillus sakei. The secondary structure of seven different repeat sequences was depicted. Recently, although detection of CRISPR/Cas systems has been highly attractive for genotyping, this intention has also been used for endogenous genome editing to improve the industrial benefits of lactic acid bacteria. This detailed study will provide a perspective on these approaches.
Keywords : Lactobacillus curvatus, Lactobacillus graminis, Lactobacillus fuchuensis, Lactobacillus sakei, CRISPR/Cas
Body

Lactobacillus curvatus is a non-starter lactic acid bacteria (NSLAB) that has a facultatively heterofermentative metabolism and curve shape (Terán et al., 2018). Even though this species has been isolated from many fermented foods such as kimchi, pickle as well as human feces, it is mostly found in meat environment and bacteriocin is produced by some strains (Eisenbach et al., 2018; Terán et al., 2018). Lactobacillus curvatus is phylogenetically related to Lactobacillus fuchuensis, Lactobacillus graminis, and Lactobacillus sakei (Hebert et al., 2012; Terán et al., 2018). Lactobacillus graminis has been isolated from grass silage, L. fuchuensis has been isolated from vacuum-packaged meat (Beck et al., 1988; Sakala et al., 2002). Lactobacillus sakei, which has two subspecies, namely, L. sakei ssp. sakei, and L. sakei ssp. carnosus, is used as a starter culture in meat fermentation and can be present in some other fermented foods such as sake, sauerkraut, sourdough (Montanari et al., 2018; Eisenbach et al., 2019; Schuster et al., 2019).

CRISPR/Cas (Clustered regularly interspaced short palindromic repeats–CRISPR-associated genes) is the immunity system of bacteria or archaea against phages or plasmids invasions (Makarova et al., 2011). CRISPR system consists of basically three steps i) adaptation, ii) expression/processing, and iii) interference. This system is divided into two classes (Class 1 and Class 2), 6 types (I-VI), and 34 subtypes according to Cas genes composition, repeat sequences, and crRNA-effector complex (Crawley et al., 2018; Makarova et al., 2018; Nethery and Barrangou, 2019; Alkhnbashi et al., 2020). Cas1 and Cas2 proteins, which are utilized in the adaptation process, exist universally in all types and Cas1 is the most conserved Cas protein (Briner et al., 2015; Makarova et al., 2018; Koonin and Makarova, 2019). Cas1 proteins belong to COG1518 in the database of Clusters of Orthologous Genes (COG), which is in the defense mechanisms category (V), while Cas2 proteins belong to COG1343 (Galperin et al., 2015). CRISPR array contains spacers and direct repeats that are partly palindromic (Lopatina et al., 2019). Repeat sequences are conserved short sequences in length 20 to 40 bases and small RNA secondary structures are known to form by some CRISPR repeats (Kunin et al., 2007; Biswas et al., 2014). CRISPR repeat sequences tend to form a stable secondary structure that is not homogeneous (Kunin et al., 2007). 40 repeat families (F1-F40) and 6 superclasses (A to F) of repeats have been defined up to date (Lange et al., 2013).

Type II-A CRISPR/Cas systems have Cas9 as a signature protein and subtype protein Csn2, however, II-C does not have this subtype protein. A small RNA, which is called the trans-activating CRISPR RNA (tracrRNA), is required for the function of type II, type V-E, and type V-B (Makarova et al., 2018). tracrRNA and pre-crRNA constitute a dsRNA and this complex is cleaved by RNAse III to create crRNA. The anti-repeat sequence, which is partially complementary to the CRISPR repeat sequence, is part of the tracrRNA (Chyou and Brown, 2019). Localizations of the putative anti-repeats in CRISPR can be as the following i) upstream or downstream of the repeat-spacer array ii) upstream of the Cas 9 chromosome, and iii) in the area between Cas 9 and Cas 1 (Krzysztof et al., 2013). The signature protein of the type I-E is Cas 3 and takes part in interference step together with Cascade complex (CRISPR-associated complex for antiviral defense) including five genes (casABCDE) (Nethery and Barrangou, 2019; Young et al., 2019).

The spacer sequences are acquired from phages or plasmids and thereby, a spacer sequence corresponds to the part of a phage or plasmid. Bacteria and phages interact with each other in their ecological habitats such as raw milk, feces, or fermented foods. Therefore, analysis of these spacer sequences will offer an insight into the ecological relationships of these species (Levin et al., 2013).

This study aims to compare CRISPR/Cas systems, Cas1, Cas2 amino acid sequences, anti-repeat sequences, as well as to analyze protospacers of these four species.

Materials and Methods

Complete genome sequences

34 whole-genome and 20 draft-genome sequences (18 L. curvatus, two L. fuchuensis, two L. graminis, and 32 L. sakei ) published up to date in NCBI (National Center for Biotechnology Information Genome Bank, January 2021) were used for the analysis (Sayers et al., 2020). Contig genomes were not included in this research.

CRISPR/Cas system identification, the predicted secondary structure of repeat sequences, and repeat family analysis

CRISPR/Cas systems, spacers, and repeats sequences were identified with CRISPR/Cas++ and CRISPRDetect tools (Grissa et al., 2007; Biswas et al., 2016). CRISPR Recognition Tool (CRT) v1.0 was used to confirm repeats swiftly (Bland et al., 2007). Additionally, CRISPR locations in the genome were also examined to decide subtypes. Type II-A has known to locate between a methionine import complex (metN, metP, metQ) and the Fe-S assembly protein genes (sufC and sufD) while type II-C locates between an ABC transporter family protein and a haloacid dehalogenase (HAD) family phosphatase (Schuster et al., 2019).

Repeat families were detected with the CRISPRmap tool v1.3.0-2013 (Lange et al., 2013). Secondary structures of repeats were depicted by using NUPACK Nucleic Acid Package (Kunin et al., 2007; Allouche, 2012). Minimum free energy, probability of secondary structure, and ensemble defect were calculated.

Visualization of CRISPR loci, cas genes

CRISPRone is a software tool that predicts CRISPR loci and finally visualizes the CRISPR array (Zhang and Ye, 2017). The tool provides array information such as localization of genes, count of repeats, and the type/subtype of CRISPR systems.

Prediction and alignment of anti-repeat sequences

CRISPRone analysis tool was used to detect locations of anti-repeat sequences and these sequences were obtained from NCBI. Sequences were aligned with ClustalW to find conserved sequences by using the MEGA X tool (Kumar et al., 2018). Alignments were visualized with Geneious Prime 2020.2.4 software (Kearse et al., 2012). Conserved sequences were emphasized through web logo design (Crooks et al., 2004).

The phylogenetic analysis of the Cas1 and Cas2 enzymes

Cas 1 and Cas 2 amino acid sequences were obtained from NCBI. All Cas1 and Cas 2 amino acid sequences were aligned with the MUSCLE alignment algorithm and the UPGMA tree was constructed by using the Jukes-Cantor method according to bootstrap 500 replicates in Geneious Prime 2020.2.4 software (Kearse et al., 2012; Pan et al., 2020).

Protospacer analyses

Protospacers belonging to a bacteriophage or plasmid were analyzed with the CRISPRTarget tool. Spacers, which are more than 10, were used as a query to search against the database by giving a cut-off score of 20 (Biswas et al., 2013). Exhibiting an identity of more than 90% between the two examined sequences (maximum one mismatch) was considered a strong protospacer match (Briner et al., 2015).

Results and Discussion

CRISPR/Cas systems, repeat sequences, and predicted secondary structure of repeats

54 genomes sequences of strains were analyzed. Genome accession numbers, genome status (whole or draft), isolation sources, Cas1, and Cas2 protein accession numbers were given in Table 1 and directions of CRISPR locus belonging to 26 strains were presented in Fig. 1. 23 type II-A, 2 type II-C, 2 type I-E CRISPR/Cas systems were found. 29 strains did not have the CRISPR/Cas system (Table 2). The highest spacer number was 92.

Genome status, accession numbers of strains and protein accession numbers of cas1 and cas2 proteins

Strains Isolation source Accession number Genome status Protein accession numbers

Cas 1 Cas 2
1. L. curvatus MRS6 fermented sausage salsiz NZ_CP022474.1 Complete WP_089556640.1 WP_076787944.1
2. L. curvatus TMW 1.1928 raw fermented sausage NZ_CP031003.1 Complete WP_076787942.1 (II-A) WP_116843571.1 (II-A)
WP_116843621.1 (I-E) WP_035186877.1 (I-E)
3. L. curvatus WiKim52 Kimchi NZ_CP016602.1 Complete WP_004270938.1 (II-A) WP_035186767.1 (II-A)
WP_004271059.1 (I-E) WP_065825767.1 (I-E)
4. L. curvatus IRG2 adult feces NZ_CP025476.1 Complete WP_126133367.1 WP_076787944.1
5. L. curvatus WiKim38 Baechu-Kimchi NZ_CP017124.1 Complete WP_004270938.1 WP_035186767.1
6. L. curvatus CBA3617 Kimchi NZ_CP042389.1 Complete WP_146955371.1 WP_035186767.1
7. L. curvatus NFH-Km12 kabura-zushi AP018699.1 Complete BBE26068.1 BBE26069.1
8. L. curvatus FBA2 radish and carrot pickled with rice bran and salt NZ_CP016028.1 Complete WP_004270938.1 WP_081273026.1
9. L. curvatus JCM 1096 = DSM 20019 milk NZ_CP026116.1 Complete WP_004270938.1 WP_128486164.1
10. L. curvatus FLEC03 Beef carpaccio NZ_LT841333.1 Draft WP_004270938.1 WP_076787944.1
11. L. curvatus VRA_2sq_f Pheasant, gastrointestinal tract NZ_WKLA01000001.1 Draft WP_154241856.1 WP_154241857.1
12. L. curvatus VRA_2sq_n pheasant, gastrointestinal tract NZ_WKKT01000001.1 Draft WP_154241856.1 WP_154241857.1
13. L. curvatus MGYG-HGUT-00020 human gut NZ_CABIVZ010000012.1 Draft WP_004270938.1 WP_035186767.1
14. L. curvatus SRCM103465 food NZ_CP035110.1 Complete ND ND
15. L. curvatus KG6 salami NZ_CP022475.1 Complete WP_089542142.1a WP_076787944.1a
16. L. curvatus ZJUNIT8 Chinese pickle NZ_CP029966.1 Complete ND ND
17. L. curvatus RI-198 unknown NZ_MKGC01000036 Draft WP_076787942.1a WP_076787944.1a
18. L. curvatus strain RI-193 unknown NZ_MKGD01000053 Draft WP_076787942.1a WP_076787944.1a
19. L. graminis DSM 20719 grass silage NZ_AYZB01000035 Draft WP_057908334.1 WP_057908333.1
20. L. graminis LG542 grass silage NZ_CP045007.1 Complete WP_057908334.1 WP_057908333.1
21. L. fuchuensis DSM 14340 vacuum-packaged beef NZ_AZEX01000047 Draft WP_025083228.1 WP_056950500.1
22. L. fuchuensis MFPC41A2801 Beef carpaccio NZ_LT984417.1 Draft WP_106483292.1 WP_056950500.1
23. L. sakei Probio65 kimchi NZ_CP020806 Draft ND ND
24. L. sakei WiKim0073 kimchi NZ_CP025203.1 Draft ND ND
25. L. sakei J18 pork sausage NZ_LT907930.1 Draft WP_100970347.1 WP_100970346.1
26. L. sakei J112 pork sausage NZ_LT907933.1 Draft WP_013728651.1 WP_112212598.1
27. L. sakei J160x1 Horse meat NZ_LT907931 Draft WP_112217705.1 WP_112217704.1
28. L. sakei J156 Pork sausage NZ_LT907929 Draft ND ND
29. L. sakei ye2 Unknown CP064817 Complete ND ND
30. L. sakei CBA3614 kimchi NZ_CP046037.1 Complete ND ND
31. L. sakei DSM 20017 = JCM 1157 moto starter of sake NZ_AP017929.1 Complete ND ND
32. L. sakei DS4 Korean kimchi NZ_CP025839.1 Complete WP_104964709.1 WP_100970346.1
33. L. sakei J64 pork sausage NZ_LT960781.1 Complete ND ND
34. L. sakei CBA3635 Unknown NZ_CP059697.1 Complete ND ND
35. L. sakei MFPB16A1401 Beef carpaccio NZ_LT960788.1 Complete ND ND
36. L. sakei MBEL1397 kimchi NZ_CP048116.1 Complete ND ND
37. L. sakei WiKim0063 cabbage NZ_CP022709.1 Complete ND ND
38. L. sakei MFPB19 Beef carpaccio NZ_LT960784.1 Complete ND ND
39. L. sakei WiKim0072 kimchi NZ_CP025136.1 Complete ND ND
40. L. sakei J54 Pork sausage NZ_LT960790.1 Complete WP_002831106.1 WP_076648253.1
41. L. sakei ZFM220 raw cow milk NZ_CP032633.1 Complete ND ND
42. L. sakei ZFM225 raw cow milk NZ_CP032635.1 Complete ND ND
43. L. sakei LZ217 fermented vegetables NZ_CP032652.1 Complete ND ND
44. L. sakei ZFM229 fermented vegetables NZ_CP032640.1 Complete ND ND
45. L. sakei LK-145 microbial mat material NZ_AP017931.1 Complete ND ND
46. L. sakei WiKim0074 kimchi NZ_CP025206.1 Complete ND ND
47. L. sakei FAM18311 food NZ_CP020459.1 Complete ND ND
48. L. sakei FLEC01 Human feces NZ_LT960777.1 Complete WP_002831106.1 WP_076648253.1
49. L. sakei 23K Unknown NC_007576.1 Complete ND ND
50. L. sakei DSM 15831 fermented meat NZ_AZFG01000025 Draft WP_013728651.1 WP_076648253.1
51. L. sakei RI-404 Unknown NZ_MKDE01000008 Draft WP_076648250.1 WP_076648253.1
52. L. sakei L15 Unknown NZ_SCIF00000000 Draft WP_112217705.1a WP_112217704.1a
53. L. sakei RI-517 cacao been fermentation NZ_MKGH01000010 Draft ND ND
54. L. sakei RI-409 Unknown NZ_MKGB01000001 Draft ND ND

ND, Not detected.

a Cas genes are present but repeat-spacer array is missing.



CRISPR/Cas systems, repeat and anti-repeat sequences of L. curvatus, L. fuchuensis, L. graminis, and L. sakei strains

Strains CRISPR Type Spacer count Repeat sequence Anti-repeat sequences
1. L. curvatus MRS6 II-A 45 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
ucacugauuugauacucuucuaaaacuacaaaccua
2. L. curvatus TMW 1.1928 II-A 20 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
I-E 29 gaatcatccccatgtatatggggagcac -
3. L. curvatus WiKim52 II-A 29 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
I-E 19 gaatcatccccatgtatatggggagcac -
4. L. curvatus IRG2 II-A 16 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
5. L. curvatus WiKim38 II-A 8 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
6. L. curvatus CBA3617 II-A 6 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
7. L. curvatus NFH-Km12 II-A 47 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
8. L. curvatus FBA2 II-A 14 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
9. L. curvatus JCM 1096= DSM 20019 II-A 15 gttgaactactcattgatttgatactcttctaaaac -
10. L. curvatus FLEC03 II-A 10 gttgaactactcattgatttgatactcttctaaaac acucaaucgaaauacucauugauuugauacucugag
11. L. curvatus VRA_2sq_f II-A 31 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
12. L. curvatus VRA_2sq_n II-A 31 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
13. L. curvatus MGYG-HGUT-00020 II-A 30 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
14. L. curvatus SRCM103465 ND ND ND ND
15. L. curvatus KG6 ND ND ND ND
16. L. curvatus ZJUNIT8 ND ND ND ND
17. L. curvatus RI-198 ND ND ND ND
18. L. curvatus strain RI-193 ND ND ND ND
19. L. graminis DSM 20719 II-A 34 gttgaactactcattgatttgatactcttctaaaac ugauuugauacucuucuaaaacuacaaaccuacaaa
acucaaucgaaauacucauugauuugauacucugag
20. L. graminis LG542 II-A 34 gttttagaagagtatcaaatcaatgagtagttcaac acucaaucgaaauacucauugauuugauacucugag
ugauuugauacucuucuaaaacuacaaaccuacaaa
21. L. fuchuensis DSM 14340 II-A 10 gttgatgaactcattgatttgatactcttctaaaac augcacuuuaacaccggauguggaucccgccuaug
22. L. fuchuensis MFPC41A2801 II-A 42 gttgatgaactcattgatttgatactcttctaaaac ucucaaccgauaaacucauugauuugauacucugg
23. L. sakei Probio65 ND ND ND ND
24. L. sakei WiKim0073 ND ND ND ND
25. L. sakei J18 II-C 92 gctattgtttccttcaacattcggttaagatgaaac ND
26. L. sakei J112 II-A 14 gttttagaagagtatcaaatcaatgagtagttcaac ND
27. L. sakei J160x1 II-A 24 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
28. L. sakei J156 ND ND ND ND
29. L. sakei ye2 ND ND ND ND
30. L. sakei CBA3614 ND ND ND ND
31. L. sakei DSM 20017=JCM 1157 (LT13) ND ND ND ND
32. L. sakei DS4 II-C 26 gctattgtttccttcaacattcggttaagatgaaat uacuauuguguccuucaaacacucgguuaagaugaag
33. L. sakei J64 ND ND ND ND
34. L. sakei CBA3635 ND ND ND ND
35. L. sakei MFPB16A1401 ND ND ND ND
36. L. sakei MBEL1397 ND ND ND ND
37. L. sakei WiKim0063 ND ND ND ND
38. L. sakei MFPB19 ND ND ND ND
39. L. sakei WiKim0072 ND ND ND ND
40. L. sakei J54 II-A 29 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
41. L. sakei ZFM220 ND ND ND ND
42. L. sakei ZFM225 ND ND ND ND
43. L. sakei LZ217 ND ND ND ND
44. L. sakei ZFM229 ND ND ND ND
45. L. sakei LK-145 ND ND ND ND
46. L. sakei WiKim0074 ND ND ND ND
47. L. sakei FAM18311 ND ND ND ND
48. L. sakei FLEC01 II-A 35 gttgaactactcattgatttgatactcttctaaaac acucaaccgaaauacucauugauuugauacucugag
49. L. sakei 23K ND ND ND ND
50. L. sakei DSM 15831 II-A 11 gttttagaagagtatcaaatcaatgagtagttcaac accgaaauacucauugauuugauacucugaguuaaaa
51. L. sakei RI-404 II-A 36 gttttagaagagtatcaaatcaatgagtggttcaac accgaaauacucauugauuugauacucugaguuaaa
52. L. sakei L15 ND ND ND ND
53. L. sakei RI-517 ND ND ND ND
54. L. sakei RI-409 ND ND ND ND

ND, Not detected.

Bold subtype was categorized according to CRISPR location (Schuster et al., 2019)



Fig. 1. Color-coded Cas genes of strains according to types/subtypes, direction of loci, and localization of anti-repeat sequences on CRISPR loci of strains. Anti-repeat sequences are located in three regions of CRISPR loci, i) upstream or downstream of the repeat-spacer array, ii) upstream of the Cas9 chromosome, and iii) in the area between Cas9 and Cas1. 100% of anti-repeat sequences were located between Cas1 and Cas9 while 3 strains had a second anti-repeat sequence at downstream region of repeat-spacer array.

CRISPR types of L. sakei strains were previously studied and L. sakei J112 was categorized as type II-A according to the location of CRISPR although it has type II-C in CRISPR/Cas++ analysis (Schuster et al., 2019).

Repeat family of two sequences belonging to type I-E was detected as 18-B. Nevertheless, repeat sequence families of other strains were not able to detect by the tool, probably, since they are unique.

Secondary structures were depicted for seven different repeat sequences (as RNA form) with ideal helical geometry, namely, (A) guuuuagaagaguaucaaaucaaugaguaguucaac (Fig. 2A), (B) gaa ucauccccauguauauggggagcac (Fig. 2B), (C) guugaacuacucauug auuugauacucuucuaaaac (Fig. 2C), (D) guugaugaacucauugauuug auacucuucuaaaac (Fig. 2D), (E) gcuauuguuuccuucaacauucgguu aagaugaaac (Fig. 2E), (F) gcuauuguuuccuucaacauucgguuaagau gaaau (Fig. 2F), (G) guuuuagaagaguaucaaaucaaugagugguucaac (Fig. 2G). The repeat sequence structure of type I-E (B) had less ensemble defect and the less normalized ensemble defect percentage.

Fig. 2. Secondary structure of repeat sequences was depicted for seven different repeat sequences as in crRNA form. (A) guuuuagaagaguaucaaaucaaugaguag uucaac, (B) gaaucauccccauguauauggggagcac, (C) guugaacuacucauugauuugauacucuucuaaaac, (D) guugaugaacucauugauuugauacucuucuaaaac (E) gcuauugu uuccuucaacauucgguuaagaugaaac, (F) gcuauuguuuccuucaacauucgguuaagaugaaau, (G) guuuuagaagaguaucaaaucaaugagugguucaac.

Prediction and alignment of anti-repeat sequences

A total of 25 anti-repeat sequences were detected and were given in Table 2. However, 56% of strains had “acucaaucg aaauacucauugauuugauacucugag” anti-repeat sequence (Fig. 3). 100% of anti-repeat sequences were located between Cas1 and Cas9 while three strains (L. curvatus MRS6, L. graminis DSM 20719, and L. graminis LG542) had anti-repeat sequences both between Cas1 and Cas9 and downstream of the repeat-spacer array (Fig. 1). The pairwise identity of sequences was 77.4%.

Fig. 3. Comparison of anti-repeat sequences of strains. 56% of strains had “acucaaucgaaauacucauugauuugauacucugag” anti-repeat sequence. The pairwise identity of sequences is 56.2%.

The phylogenetic analysis of the Cas1 and Cas2 enzymes

Cas1 and cas2 are common genes that occur in every CRISPR type and are involved in the spacer acquisition process. Phylogenetic tree analysis of Cas1 (Fig. 4A) and Cas2 (Fig. 4B), revealed that strains tended to cluster according to CRISPR/Cas subtype, namely, II-A, I-E, andII-C. Alignment results also revealed that Cas1 and Cas2 proteins of L. curvatus strains had a more similar sequence pattern among strains, which have type II-A, than L. sakei strains.

Fig. 4. UPGMA trees of Cas proteins were constructed with Geneious Prime 2020.2.4. Black and gray colors indicate agreements to consensus. Cas1 and Cas2 revealed a phylogenetic pattern according to CRISPR subtypes I-E, II-C, and II-A. The accession numbers of Cas1 and Cas2 proteins were given in Table 1. (A) Phylogenetic tree and alignment of Cas1 amino acid sequences and pairwise identity is 65.9% (B) Phylogenetic tree and alignment of Cas2 amino acid sequences and pairwise identity is 59.6%.

Protospacer analyses

Spacer sequences are DNA segments acquired by bacteria or archaea from either an invading phage or plasmid (protospacer). Thereby, protospacer sequences correspond to phage or plasmid. In this study, according to match parameters, a tremendous plasmid invasion of lactic acid bacteria revealed eight strains isolated from fermented sausage, pork sausage, adult feces, kabura-zushi, beef carpaccio, and milk (Table 3). Common invaders of strains were detected as Pediococcus damnosus, Pediococcus claussenii, L. backii, L. plantarum, L. brevis, L. curvatus, and L. sakei. Nevertheless, any phage was not able to detect since the results did not meet match criteria.

Protospacer analysis results of L. curvatus, L. fuchuensis, L. graminis, and L. sakei strains

Strains Plasmid invaders
L. curvatus TMW 1.1928 1. damnosus strain TMW 2.1533 plasmid pL21533-7
2. backii strain TMW 1.1989 plasmid pL11989-3
3. plantarum strain Q7 plasmid
4. sakei strain CBA3614 plasmid
5. claussenii ATCC BAA-344 plasmid pPECL-3
6. sakei strain FAM18311 plasmid pFAM18311_2

L. curvatus IRG2 1. damnosus strain TMW 2.1535 plasmid pL21535-1
2. claussenii ATCC BAA-344 plasmid pPECL-6
3. backii strain TMW 1.1989 plasmid pL11989-3
4. plantarum strain EM plasmid pEM7
5. paracollinoides strain TMW 1.1994 plasmid pL11994-1

L. curvatus NFH-Km12 1. Lactobacillus plantarum plasmid pMK10
2. plantarum plasmid pLR1
3. plantarum strain CAUH2 plasmid pCAUH201

L. curvatus JCM 1096 1. cibaria strain BM2 plasmid pBM2
2. mesenteroides subsp. jonggajibkimchii strain DRC1506 plasmid pDRC3
3. backii strain TMW 1.2002 plasmid pL12002-6
4. sakei strain WiKim0063 plasmid pLBS02
5. brevis strain UCCLBBS449 plasmid pUCCLBBS449_E

L. fuchuensis MFPC41A2801 1. curvatus strain ZJUNIT8 plasmid
2. brevis strain UCCLB95 plasmid
3. mesenteroides strain SRCM103356 plasmid
4. carnosum strain MFPC16A2803 genome assembly, plasmid: pMFPC16A2803B
5. inopinatus strain DSM 20285 plasmid pLDW-14

L. curvatus MGYG-HGUT-00020 1. malefermentans strain CBA3618 plasmid
2. brevis strain ZLB004 plasmid p4
3. buchneri NRRL B-30929 plasmid pLBUC03
4. claussenii ATCC BAA-344 plasmid pPECL-3
5. paracollinoides strain TMW 1.1995 plasmid pL11995-1
6. brevis strain ZLB004 plasmid p2

L. sakei J18 1. Lactiplantibacillus plantarum strain HC-2 plasmid
2. Lactiplantibacillus plantarum strain Y44 plasmid pY44-1
3. Lactiplantibacillus plantarum strain CACC 558 plasmid p1CACC558
4. Lactiplantibacillus plantarum strain SPC-SNU 72-2 plasmid pLBP458

L. sakei RI-404 1. Lactiplantibacillus plantarum strain K25 plasmid
2. Lactobacillus sakei strain KCA311 plasmid pKCA15
3. Lactobacillus sakei strain KCA311 plasmid pKCA9
4. Lactobacillus coryniformis subsp. torquens DSM 20004 plasmid pLDW-6
5. Lactobacillus backii strain TMW 1.1989 plasmid pL11989-2
6. Lactobacillus brevis strain SRCM101174 plasmid pLB1174-4


Lactobacillus curvatus strains can exist in different ecological niches such as human feces or fermented food. In these environments, species encounter many invaders and acquire immunity to these foreign DNAs through systems such as CRISPR. Comprehensively exploration of CRISPR/Cas systems has become an approach to investigate the pathogen-host interaction, host recognition in metagenomes, evolutionary studies, and also a tool to modify genomes of both prokaryotic and eukaryotic cells (Hargreaves et al., 2014; Hidalgo-Cantabrana et al., 2018). Lactobacillus curvatus is known to be related to L. fuchuensis, L. sakei, and L. graminis. In this study, this relationship was investigated in terms of CRISPR system elements. The protospacer analysis revealed common invaders of strains. CRISPR system of L. fuchuensis MFPC41A2801 had a protospacer sequence from a plasmid of Lactobacillus curvatus strain.

Recently, endogenous genome editing of lactic acid bacteria has been started to be assessed to perform some industrial applications and to develop phage-resistant starter cultures (Barrangou and Dudley, 2016; Hidalgo-Cantabrana et al., 2019; Pan and Barrangou, 2020; Roberts and Barrangou, 2020). Therefore, CRISPR/Cas system prediction of species has been the first step and main perspective in these studies. Besides genome editing, investigation of the CRISPR/Cas systems has been an approach to genotyping studies. CRISPR/Cas systems have been compared in several studies (Barrangou and Dudley, 2016; Hu et al., 2020). The evolution and classification of these systems are still under investigation (Makarova et al., 2018; Koonin and Makarova, 2019). Therefore, this research has provided a perspective on these approaches.

Acknowledgments

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

References
  1. Alkhnbashi OS, Meier T, Mitrofanov A, Backofen R, and Voß B. 2020. CRISPR-Cas bioinformatics. Methods 172, 3-11.
    Pubmed CrossRef
  2. Allouche AR. 2012. Gabedit - a graphical user interface for computational chemistry softwares. J. Comput. Chem. 32, 174-182.
    Pubmed CrossRef
  3. Barrangou R and Dudley EG. 2016. CRISPR-based typing and next-generation tracking technologies. Annu. Rev. Food Sci. Technol. 7, 395-411.
    Pubmed CrossRef
  4. Beck R, Weiss N, and Winter J. 1988. Lactobacillus graminis sp. nov., a new species of facultatively heterofermentative lactobacilli surviving at low pH in grass silage. Syst. Appl. Microbiol. 10, 279-283.
    CrossRef
  5. Biswas A, Fineran PC, and Brown CM. 2014. Accurate computational prediction of the transcribed strand of CRISPR non-coding RNAs. Bioinformatics 30, 1805-1813.
    Pubmed CrossRef
  6. Biswas A, Gagnon JN, Brouns SJJ, Fineran PC, and Brown CM. 2013. CRISPRTarget: bioinformatic prediction and analysis of crRNA targets. RNA Biol. 10, 817-827.
    Pubmed KoreaMed CrossRef
  7. Biswas A, Staals RHJ, Morales SE, Fineran PC, and Brown CM. 2016. CRISPRDetect: A flexible algorithm to define CRISPR arrays. BMC Genomics 17, 356.
    Pubmed KoreaMed CrossRef
  8. Bland C, Ramsey TL, Sabree F, Lowe M, Brown K, Kyrpides NC, and Hugenholtz P. 2007. CRISPR Recognition Tool (CRT): a tool for automatic detection of clustered regularly interspaced palindromic repeats. BMC Bioinformatics 8, 209.
    Pubmed KoreaMed CrossRef
  9. Briner AE, Lugli GA, Milani C, Duranti S, Turroni F, Gueimonde M, Margolles A, Van Sinderen D, Ventura M, and Barrangou R. 2015. Occurrence and diversity of CRISPR-Cas systems in the genus Bifidobacterium. PLoS ONE 10.
    Pubmed KoreaMed CrossRef
  10. Chyou T and Brown CM. 2019. Prediction and diversity of tracrRNAs from type II CRISPR-Cas systems. RNA Biol. 16, 423-434.
    Pubmed KoreaMed CrossRef
  11. Crawley AB, Henriksen ED, Stout E, Brandt K, and Barrangou R. 2018. Characterizing the activity of abundant, diverse and active CRISPR-Cas systems in lactobacilli. Sci. Rep. 8.
    Pubmed KoreaMed CrossRef
  12. Crooks GE, Hon G, Chandonia JM, and Brenner SE. 2004. WebLogo: A sequence logo generator. Genome Res. 14, 1188-1190.
    Pubmed KoreaMed CrossRef
  13. Eisenbach L, Geissler AJ, Ehrmann MA, and Vogel RF. 2019. Comparative genomics of Lactobacillus sakei supports the development of starter strain combinations. Microbiol. Res. 221, 1-9.
    Pubmed CrossRef
  14. Eisenbach L, Janßen D, Ehrmann MA, and Vogel RF. 2018. Comparative genomics of Lactobacillus curvatus enables prediction of traits relating to adaptation and strategies of assertiveness in sausage fermentation. Int. J. Food Microbiol. 286, 37-47.
    Pubmed CrossRef
  15. Galperin MY, Makarova KS, Wolf YI, and Koonin EV. 2015. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res. 43, D261-D269.
    Pubmed KoreaMed CrossRef
  16. Grissa I, Vergnaud G, and Pourcel C. 2007. The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics 8, 172.
    Pubmed KoreaMed CrossRef
  17. Hargreaves KR, Flores CO, Lawley TD, and Clokie RJ. 2014. Abundant and diverse clustered regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and prophages target multiple phage types within this pathogen. mBio 5, e01045-13.
    Pubmed KoreaMed CrossRef
  18. Hebert EM, Saavedra L, Taranto MP, Mozzi F, Magni C, Nader MEF, de Valdez GF, Sesma F, Vignolo G, and Raya RR. 2012. Genome sequence of the bacteriocin-producing Lactobacillus curvatus strain CRL705. J. Bacteriol. 194, 538-539.
    Pubmed KoreaMed CrossRef
  19. Hidalgo-Cantabrana C, Goh YJ, Pan M, Sanozky-Dawes R, and Barrangou R. 2019. Genome editing using the endogenous type I CRISPR-Cas system in Lactobacillus crispatus. Proc. Natl. Acad. Sci. USA 116, 15774-15783.
    Pubmed KoreaMed CrossRef
  20. Hidalgo-Cantabrana C, Sanozky-Dawes R, and Barrangou R. 2018. Insights into the human virome using CRISPR spacers from microbiomes. Viruses 10, 479.
    Pubmed KoreaMed CrossRef
  21. Hu T, Cui Y, and Qu X. 2020. Characterization and comparison of CRISPR Loci in Streptococcus thermophilus. Arch. Microbiol. 202, 695-710.
    Pubmed CrossRef
  22. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, and Duran CDuran C, et al. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647-1649.
    Pubmed KoreaMed CrossRef
  23. Koonin EV and Makarova KS. 2019. Origins and evolution of CRISPR-Cas systems. Phil. Trans. R. Soc. B. 374.
    Pubmed KoreaMed CrossRef
  24. Krzysztof C, Le RA, and Emmanuelle C. 2013. The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems. RNA Biol. 10, 726-737.
    Pubmed KoreaMed CrossRef
  25. Kumar S, Stecher G, Li M, Knyaz C, and Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547-1549.
    Pubmed KoreaMed CrossRef
  26. Kunin V, Sorek R, and Hugenholtz P. 2007. Evolutionary conservation of sequence and secondary structures in CRISPR repeats. Genome Biol. 8, R61.
    Pubmed KoreaMed CrossRef
  27. Lange SJ, Alkhnbashi OS, Rose D, Will S, and Backofen R. 2013. CRISPRmap: An automated classification of repeat conservation in prokaryotic adaptive immune systems. Nucleic Acids Res. 41, 8034-8044.
    Pubmed KoreaMed CrossRef
  28. Levin BR, Moineau S, Bushman M, and Barrangou R. 2013. The population and evolutionary dynamics of phage and bacteria with CRISPR-mediated immunity. PLoS Genet. 9.
    Pubmed KoreaMed CrossRef
  29. Lopatina A, Medvedeva S, Artamonova D, Kolesnik M, Sitnik V, Ispolatov Y, and Severinov K. 2019. Natural diversity of CRISPR spacers of Thermus: evidence of local spacer acquisition and global spacer exchange. Phil. Trans. R. Soc. B. 374.
    Pubmed KoreaMed CrossRef
  30. Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E, Horvath P, Moineau S, Mojica FJM, Wolf YI, and Yakunin AFYakunin AF, et al. 2011. Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 9, 467-477.
    Pubmed KoreaMed CrossRef
  31. Makarova KS, Wolf YI, and Koonin EV. 2018. Classification and nomenclature of CRISPR-Cas Systems: where from here?. CRISPR. J. 1, 325-336.
    Pubmed KoreaMed CrossRef
  32. Montanari C, Barbieri F, Magnani M, Grazia L, Gardini F, and Tabanelli G. 2018. Phenotypic diversity of Lactobacillus sakei strains. Front. Microbiol. 9, 2003.
    Pubmed KoreaMed CrossRef
  33. Nethery MA and Barrangou R. 2019. Predicting and visualizing features of CRISPR-Cas systems. Methods Enzymol. 616, 1-25.
    Pubmed CrossRef
  34. Pan M and Barrangou R. 2020. Combining omics technologies with CRISPR-based genome editing to study food microbes. Curr. Opin. Biotechnol. 61, 198-208.
    Pubmed CrossRef
  35. Pan M, Nethery MA, Hidalgo-Cantabrana C, and Barrangou R. 2020. Comprehensive mining and characterization of CRISPR-Cas systems in Bifidobacterium. Microorganisms 8, 720.
    Pubmed KoreaMed CrossRef
  36. Roberts A and Barrangou R. 2020. Applications of CRISPR-Cas systems in lactic acid bacteria. FEMS Microbiol. Rev. 44, 523-537.
    Pubmed CrossRef
  37. Sakala RM, Kato Y, Hayashidani H, Murakami M, Kaneuchi C, and Ogawa M. 2002. Lactobacillus fuchuensis sp. nov., isolated from vacuum-packaged refrigerated beef. Int. J. Syst. Evol. Microbiol. 52, 1151-1154.
    Pubmed CrossRef
  38. Sayers EW, Cavanaugh M, Clark K, Ostell J, Pruitt KD, and Karsch-Mizrachi I. 2020. GenBank. Nucleic Acids Res. 48, D84-D86.
    Pubmed KoreaMed CrossRef
  39. Schuster JA, Vogel RF, and Ehrmann MA. 2019. Characterization and distribution of CRISPR-Cas systems in Lactobacillus sakei. Arch. Microbiol. 201, 337-347.
    Pubmed CrossRef
  40. Terán LC, Coeuret G, Raya R, Zagorec M, Champomier-Vergès MC, and Chaillou S. 2018. Phylogenomic analysis of Lactobacillus curvatus reveals two lineages distinguished by genes for fermenting plant-derived carbohydrates. Genome Biol. Evol. 10, 1516-1525.
    Pubmed KoreaMed CrossRef
  41. Young JK, Gasior SL, Jones S, Wang L, Navarro P, Vickroy B, and Barrangou R. 2019. The repurposing of type I-E CRISPR-Cascade for gene activation in plants. Commun. Biol. 2, 383.
    Pubmed KoreaMed CrossRef
  42. Zhang Q and Ye Y. 2017. Not all predicted CRISPR-Cas systems are equal: isolated cas genes and classes of CRISPR like elements. BMC Bioinformatics 18, 92.
    Pubmed KoreaMed CrossRef


March 2021, 57 (1)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information