search for




 

Characterization and expression of SabA and BabA genes in Helicobacter pylori under varying pH
Korean J. Microbiol. 2021;57(2):83-90
Published online June 30, 2021
© 2021 The Microbiological Society of Korea.

Hamzah Abdulrahman Salman1*, Eman Mobder Nayif1, and Anmar Hameed Bloh2

1Department of Medical Laboratory Techniques, College of Medical Sciences Techniques, The University of Mashreq, Baghdad 10023, Iraq
2Department of Radiology and Sonography Techniques, Al-Rafidain University College, Baghdad 10014, Iraq
Correspondence to: E-mail: hamzah.abdulrahman@uom.edu.iq; Tel.: +964-7732914480
Received March 2, 2021; Revised May 23, 2021; Accepted June 2, 2021.
Abstract
Helicobacter pylori is a potential cause for peptic ulcers which can make persistent chronic infection. Helicobacter pylori produce urease at low pH to neutralize the acidic environment to colonize the gastric mucosa. This investigation aimed to characterize H. pylori based on urease, adherence, motility, and biofilm activity and to determine the gene expression of SabA and BabA by real-time qRT-PCR. The reference culture H. pylori ATCC 49503 was employed in the current study. The characterization of H. pylori, such as biofilm, urease, adherence, and motility assays, was determined in acidic environments with the supplement of urea substrate. Real-time qRT-PCR was executed to find the possible explanation for the colonization by the genes actin, SabA, and BabA. The study indicated that urea substrate is important in biofilm activity, adherence, motility, and urease of H. pylori. Helicobacter pylori ATCC 49503 showed enhanced activity at pH 2.5 only when supplemented with urea substrate. Real-time qRT-PCR confirmed the positive and significant expression of the SabA and BabA genes in an acidic environment and its cooperative role in biofilm and the motility of H. pylori. The results propose that urease within H. pylori is necessary to neutralize the acidic niche and colonize effectively within the mucosal layers of the stomach. Additionally, the colonization and adaptability of H. pylori in the in vitro were dependant on urease and pH. Further studies are proposed to understand the colonization of clinical strains of H. pylori.
Keywords : BabA, H. pylori, SabA, gene expression, real-time qRT-PCR, urease activity
Body

Helicobacter pylori is considered the first known human infectious carcinogenic bacteria to inhabit the stomach of more than half of the world’s residents (Kusters et al., 2006). It is also considered among the most prevalent human microbe. Unless treated, H. pylori infection lasts lifelong and plays a crucial role in the etiology of many digestive ailments such as asymptomatic gastritis, gastric adenocarcinoma, and lymphomas (Hooi et al., 2017; Melese et al., 2019; Wang et al., 2019). Helicobacter pylori is spiral Gram-negative bacteria that live within the gastrointestinal tract by liberating urease to adapt itself to the harsh acidic environment (Kusters et al., 2006). Even within a pH 2.5, H. pylori could persist as urea converted into ammonia by urease which neutralizes the gastric acid (Kusters et al., 2006). Once infected into the mucosal layers, H. pylori causes gastric-related ailments (Dunn et al., 1997).

The spread of H. pylori is not yet clear; nevertheless, fecal-oral or oral-oral routes are the most suggested method of transmission (Bui et al., 2016; Mamishi et al., 2016). Due to the socioeconomic status of individuals, H. pylori is more ubiquitous in people living in developing countries (Ozbey and Hanafiah, 2017). Disease and symptoms are due to complex interactions between the host and the pathogen (Singer, 2010).

Recent studies have shown that ammonia produced by urease, causing irreversible damage to gastroduodenal mucous membranes (Follmer, 2010; Graham and Miftahussurur, 2018). Specific urease inhibition studies confirmed that urease-negative mutant did not cause gastritis among the mice as colonization was lost entirely (Olivera-Severo et al., 2017; Graham and Miftahussurur, 2018).

Urease is not only produced by H. pylori but also by Proteus mirabilis and Staphylococcus saprophyticus. This enzyme plays a pivotal role in H. pylori virulence and colonization within the gastric mucosa. Also, it elicits a robust immune response making it a potent immunogenic (Valenzuela-Valderrama et al., 2019). It is also used in taxonomic identification and diagnosis, prophylaxis, and considered a vaccine candidate. Furthermore, many virulence factors are also believed to be responsible for colonization and urease, like motility, biofilm, exotoxin genes, mucinase, and adhesion factors (Kao et al., 2016).

Both urease activity and motility are needed for colonization (Rolig et al., 2012; Fagoonee and Pellicano, 2019). This action reduces the viscosity and elasticity of the mucus layer, which affects the viscous solution by increasing the pH, making it easier for the bacteria to penetrate the mucus. This activity level is seen especially in low pH (2.5) (Follmer, 2010; Modolo et al., 2015).

In addition to the above factors, H. pylori adhesins, i.e., binding adhesin A (BabA) and sialic acid-binding adhesin (SabA) display an essential role in the pathogenicity (Yılmaz and Koruk Özer, 2019). Some of the virulence-related factors like the gene associated with cytotoxin (CagA) and the gene associated with vacuolating cytotoxin (VacA) also help the strains to colonize the gastric mucosa (Kusters et al., 2006; Mendoza-Cantú et al., 2017). In context to the above, the current study was designed to find the possible cooperative role of gene expression of SabA and BabA in initiating other virulence factors of H. pylori at varying pH. In addition, we tried to determine the role of substrate (Urea) utilization at varying pH, which could explain the importance of acidic environments. The objectives were studied using urease activity, biofilm, motility, and adherence assays.

Materials and Methods

Bacterial strain

Helicobacter pylori ATCC 49503 was employed in the present study. This specific strain was reported to have VacA and CagA genes, which is considered the key to the pathogenicity of H. pylori. Moreover, this strain may induce apoptosis in the colonized mucosa. Brain heart infusion (BHI) broth (HiMedia) was used for culturing H. pylori. The broth enhanced with 6% fetal calf serum (Sigma Aldrich) and 0.25% yeast extract (Qualigens) along with vancomycin (10 mg/L) and amphotericin (50 mg/L) and incubated at 37°C for 5–7 days with aeration (5–6% O2, 10% CO2, 80–85% N2) (Ndip et al., 2003). The growth of the bacteria was maintained optimum by checking the optical density (OD) at 580 nm.

Experimental setup

In brief, 0.4 ml of BHI broth was added to all the wells in 24 well plates. The medium was adjusted to varying pH conditions (2.5, 3.5, 4.5, 5.5, 6.5, and 7.5) with 0.1 N HCl. The first two rows of the plate were added with 10 mM urea, and the last two rows with no urea added. Twenty microliters of overnight H. pylori culture (OD value 0.7) were added to all the wells except the negative controls. The plates were incubated at 37°C until optimum growth was observed. Following assays were done to confirm the aimed objectives. The negative control was performed on a separate plate.

Biofilm formation assay

Biofilm forming test was carried out using ethanol acetone method as explained by (O'Toole et al., 1999). In brief, the plates loaded as previously were incubated at 37°C for 24 h. After incubation, the wells were washed three times with phosphate-buffered saline (PBS). Two percent of crystal violet was used to staining the wells for about 25 min. The stain was then solubilized with ethanol:acetone (80:20), and the absorbance was recorded at 590 nm.

Primary adherence assay

The plates loaded as previously were incubated at 37°C for 24 h. Overnight cultures were diluted to an absorbance of 0.1 at 578 nm with BHI. After 2 h incubation, 10 ml of this culture was poured into Petri plates (size 150 mm × 15 mm) and incubated for 2 h at 37°C. Following incubation, plates were washed with PBS, and glycerine solution was poured into the plates to fix the colonies. The cells were Gram stained and observed under 40× by recording the average count for 5 microscopic fields.

Urease activity

The rate of ammonia emitted by hydrolyzing urea was estimated at urease activity (Young et al., 1996). In brief, the cultured cells were spun down, and the pellet was washed with PBS buffer. To the suspension, 40 μl of test buffer (0.1% [w/v] CTAB; 0.6% [w/v] NaCl, 100 mM citrate, 5 mM urea, pH = 6.0) was added and mixed thoroughly. The reaction was stopped first with 100 μl of phenol nitroprusside and then 100 μl alkaline hypochlorite. Then the suspension was recorded for absorbance at 635 nm after 30 min incubation. Protein concentration was quantified with Lowry’s method, using BSA as standard. Ammonia concentration of the samples was estimated using a standard graph of NH4Cl, and urease activity was expressed as µmole of ammonia generated per min per mg of protein.

Motility assay

The motility of the cells in the acidic environments was assessed by the wet mount method as described by (Ottemann and Lowenthal, 2002). Motility was evaluated with soft agar plates composed of BHI broth, 5% FBS, 0.35% agar. The experiment was done in two plates; the first was supplemented with urea substrate (U+) while the second plate was not supplied with urea substrate (U-). The pH of the plates was maintained at 2.5 with dilute HCl. A small loop of culture was stabbed about 3/4th of the way into the agar medium. The same was estimated with and without substrate urea (10 mM). The plates were then incubated at 37°C, and the diameter of the bacterial halo was recorded for 48 h. The diameter of the colony is proportional to the motility.

RNA purification

The same experimental setup was carried, but at only one pH treatment (pH 2.5). The experiment was done in triplicates. The plate after inoculation was incubated at 37°C for 24–48 h. In brief, 10 ml of ice-cold 5% water-saturated phenol (pH 5.5) was added to protect the RNA from degradation. Following incubation, the cultured cells of H. pylori were spun out to extract the total RNA for expression studies. The pellet was re-suspended in 5 ml of lysis buffer (0.5 mg/ml lysozyme, 10 mM Tris-HCl, 1 mM EDTA; pH 8, 0–1% SDS) and incubated in a water bath at 64°C for 2 min. The incubation was completed and extracted with 5.5 ml of 1 M sodium acetate (pH 5.2) of equivalent phenol saturated with water (pH 5.5) and incubating at 64°C for 6 min. Then the upper aqueous phase with the same amount of chloroform was recaptured, and the RNA was precipitated by ethanol. The collected RNA has been recovered in RNase/DNases free water in preparation for real-time qRT-PCR.

Real-time quantitative Reverse Transcription PCR (Real-Time qRT-PCR)

Real-Time qRT-PCR was employed in the present study following the protocol prescribed by Rokbi et al. (2001), with few modifications. Briefly, the synthesis of cDNA was done by random primers, and 2 μg of total RNA with 1 U of SuperScript II reverse transcriptase (Invitrogen). The cDNA used in the PCR amplification was 1.3 µl. The primers used in this reaction were listed in Table 1. The real-time qRT-PCR assay was then executed using the iQTM SYBR Green Supermix (Bio-Rad Laboratories). The primers (600 nM) and 1 μl of cDNA were used with a total volume of 12.5 μl. Tests and their particular negative control were duplicated to confirm the positive amplification. Real-time qRT-PCR was carried out in the Corbett Research Cycler (Bio-Rad Laboratories). The negative control involved was the PCR mixture without a DNA template. Expression profiling was assayed by the 2-∆∆Ct method. The Ct values for the genes of interest (BabA and SabA) were standardized to their housekeeping gene. Since actin expression was found unaffected under treatments, we considered it a housekeeping gene.

Primers used in the study

Primer Primer sequence Tm Length Product size (bp)
BabA-F ATGAAAAAACACATCCTTTCATTA 52.5 24 219
BabA-R TTATTCAAATACACGCTATAGAGTCTT 57.4 27
SabA-F CTCTCTCTCGCTTGCGGTAT 59.4 20 187
SabA-R TTGAATGCTTTGCCTCAATG 53.2 20
Actin F AAGATGACCCAGATCATGTT 54.2 20 142
Actin R GCGACATAGCACAGCTTCT 56.3 19


Ct values are inversely related to the quantity of the nucleic acid present in the test sample, i.e., the lower the Ct value, the more is the DNA in the sample. The average of the duplicate values was taken, both for the housekeeping gene (actin) and the gene of interest (BabA and SabA). The Ct values obtained for each gene were normalized to its housekeeping gene called the ∆Ct value.

ΔCt=Ct of the gene of interest-Ct of the housekeeping gene

The relative levels of expression of a particular gene of interest are calculated with its ∆Ct values. The sample with low ∆Ct values can be taken as a calibrator. The ∆∆Ct was then calculated by subtracting two ∆Ct values.

ΔΔCt=ΔCt of test sample-ΔCt of calibrator

This ∆∆Ct is then used for calculating the relative expression of the gene of interest with other members. Thus, the samples are compared for their relative levels of expression.

Statistical analysis

Graphpad Prism software version 9 (Graphpad, Inc.) was used to analyze the present study. A two-way ANOVA was done to find the correlation between the samples and substrate treatments. All the values were the average of triplicates, and the significance values were P < 0.05.

Results

Biofilms activity

Helicobacter pylori ATCC 49503 demonstrated biofilm production. The biofilm formation of H. pylori at different pH concentrations with the presence and absence of urea is demonstrated in (Fig. 1). The activity of biofilm increased with a rise in the pH from 2.5 to 7.5. A two-way ANOVA showed a significant effect (P < 0.05) of different pH and urea. The significance effect of the pH and urea was reported on the biofilm formation (F [1,5] = 17.83951, p = 0.008298) and (F [5,5] = 8.901235, p = 0.015743).

Fig. 1. Biofilm formation at varying pH treatments with and without urea. All the values are average of triplicates and represented as value ± SD.

Adherence assay

The adherence of the H. pylori was found to be a high level in the presence of urea. The cell adherence of H. pylori at different concentrations of pH with presence and absence of urea is presented in (Fig. 2). A two-way ANOVA was conducted to compare the effect of urea on adherence assay. The significance effect (P < 0.05) of the pH and urea was reported on the adhering ability (F [1,5] = 4.799759, p = 0.008001) and (F [5,5] = 5.078058, p = 0.041477).

Fig. 2. Cell count adherence at varying pH treatments with and without urea. All the values are average of triplicates, and average counts are taken from five focus areas.

Urease activity

It was observed that urease activity is shown high (108 µmole/min/mg) in the cells exposed to a highly acidic environment (pH 2.5). The activity of urease of H. pylori at different concentrations of pH with the presence and absence of urea is shown in (Fig. 3). A two-way ANOVA was conducted to compare the effect of urease activity. The significance effect (P < 0.05) of the pH and urea was reported on the activity of urease (F [1,5] = 6.7882, p = 0.047934) and (F [5,5] = 6. 424263, p=0.03165).

Fig. 3. Urease activity at varying pH treatments with and without urea. Values are expressed in µmole/min/mg.

Motility assay

The motility of H. pylori on an acidic medium is shown in Fig. 4. In plate U-(without substrate), colony size was minimal due to a high acidic environment. While in plate U+ (with substrate), the colony size is significant, which indicates the motility of H. pylori.

Fig. 4. Motility of H. pylori on acidic medium (BHI, pH 2.5) with and without substrate. U+, with substrate; U-, without substrate.

Gene expression by real-time qRT-PCR

Different quantification curves of the gene expression of H. pylori using real-time qRT-PCR were demonstrated in Fig. 5. The gene expression of actin was 100%, while the gene expression of BabA and SabA were varied according to the presence and absence of urea substrate. The 2-ΔΔCt values for the gene members at pH 2.5 with and without substrate are shown in (Fig. 6). A two-way ANOVA between the genes and urea substrate was conducted to compare the expression levels. There was a significant (P < 0.05) effect observed between control (without urea substrate) and treatment (urea substrate), but no significant effect was seen between the genes (BabA and SabA) expression. The significant effect of both control and treatment on gene expression was (F [2,2] = 28.76, p = 0.0346) and (F [1,2] = 13.5, p=0.1884).

Fig. 5. Quantification curves of gene expression by real-time qRT-PCR. (A) Actin gene, (B) BabA and SabA genes without urea substrate and pH 2.5, (C) BabA and SabA genes with the presence of urea substrate and pH 2.5.

Fig. 6. The 2-ΔΔCt values of BabA and SabA genes at pH 2.5 with and without substrate.
Discussion

Helicobacter pylori colonizes the stomach and duodenum, responsible for gastritis, ulcer, and cancer of the gastrointestinal tract (Ansari and Yamaoka, 2019). Bacterial cultures normally do not thrive at low pH (2.5, acidic), but Helicobacter would usually adapt to such an environment by producing urease enzyme (Graham and Miftahussurur, 2018). This was visible from the assay at pH 2.5, lacking urea (Fig. 1). The cells were unable to synthesize urease, therefore, no growth was observed in an acidic environment, this is in accordance with the previous reports (Olivera-Severo et al., 2017; Graham and Miftahussurur, 2018). The biofilm formation was maximum (0.28 ± 0.08) at neutral pH (7.5). However, at pH 2.5, the biofilm was found to be 0.18 nm and 0.03 nm in the presence and absence of urea, respectively (Fig. 1). The findings are consistent with previous studies (Yonezawa et al., 2015; Hathroubi et al., 2018a).

The adherence or cell count was found to be 546 and 8 at pH 2.5 in the presence and absence of urea, respectively (Fig. 2). The cell count was found to be a maximum of 843 and 823 at pH 7.5 with the presence and absence of urea, respectively (Fig. 2). The result is in accordance with the previous report (Bugaytsova et al., 2017). Moreover, the formation of biofilm could improve the virulence factor of the microorganism by increasing the adherence to the cell (Hathroubi et al., 2018b).

As the pH increases, the urease activity was seen to be reduced (Fig. 3). This finding revealed that urease activity is a protective means to save the cells from the acidic environment. This urease activity nullifies or neutralizes the acidic environment, which is similar to the previously reported study (Abadi, 2017). Similar findings were found in recent reports stating that H. pylori synthesizes urease at acidic pH, which agrees with the present study’s findings (Scott et al., 1998; Ansari and Yamaoka, 2017b). The value seems to reduce from 108 µmole/min/mg to 21 µmole/min/mg at pH 2.5 and 7.5, respectively. It was indicated from several reports that many of the bacterial species need enzymatic activity of urease and hydrogenase to effectively colonize among the acidic territories (Benoit et al., 2013; Blum et al., 2017).

Our results indicated that the motility of H. pylori is affected by urea substrate and urease enzyme. In plate U-(without substrate), colony growth was not seen as could be due to a highly acidic environment. On the contrary, in U+ (with substrate), the colonies were big, confirming the mobility via colonization (Fig. 4). This could be due to the neutralization of the acidic environment by utilizing urea substrate by urease enzyme. Our findings are similar to the studies done earlier that found that chemotactic motility was more in urease-positive bacteria than the urease-negative strain (Nakamura et al., 1998; Gu, 2017; Johnson and Ottemann, 2018).

Throughout the study, the results and Ct values were normalized to the housekeeping gene (actin) to decrease the variances among the genes (Fig. 6). The mRNA of both genes (BabA and SabA) have been studied separately with and without substrates. The sample with the lower ΔΔCt values 11 was taken as a calibrator. The actin gene expression was found to be 100% in the study.

The Ct values for the genes BabA and SabA in the presence of substrate were almost similar and found to be 25 and 24, respectively (Fig. 6). On the other hand, the Ct values for the genes BabA and SabA in the absence of substrate were again similar and negligible in expression (more than 31). Ct values of less than 28 were considered expressive.

In respect to the present data and 2-ΔΔCt values (Fig. 6), it was observed that BabA and SabA genes were expressed even at lower pH of 2.5. These results are again in accordance with the biofilm (Fig. 1) and urease activity (Fig. 3) of the present study. The Ct value of the actin was found to be 11. In the presence of urea, the expression of the BabA and SabA was 64 and 56 times more compared with the absence of urea. This confirms the possible expression of these genes for rapid colonization and viability in a very high acidic environment. However, this is consistent with the findings of the recent studies that found BabA and SabA are the primary genes of adhesins of H. pylori which aids in colonization and motility (Ansari and Yamaoka, 2017a; Benktander et al., 2018; Zhao et al., 2020). Moreover, the SabA gene is the key component for the initial colonization of H. pylori and is expressed more during chronic inflammation (Benktander et al., 2018).

Conclusion

The present study concluded that H. pylori ATCC 49503 have different virulence factors such as urease, biofilm, mobility, and adherence activities; these were expressed at a high-level acidic environment with the presence of urea substrate. Moreover, at low pH, the gene expression of BabA and SabA was elevated with urea substrate. This study demonstrated the significant effect of BabA and SabA in biofilm and the motility of the pathogen. Additionally, our study indicated that the colonization and adaptability of H. pylori in the in vitro conditions were found to be urease and pH dependant. However, the research was done only on one strain; further studies in clinical strains are required to confirm and validate the current findings. Additional studies are strongly warranted to execute widespread and multidisciplinary research to understand the virulence factors of H. pylori.

Acknowledgments

No financial assistance or grant was reprieved for this project.

Conflict of Interest

There are no conflicts of interest.

References
  1. Abadi ATB. 2017. Strategies used by Helicobacter pylori to establish persistent infection. World J. Gastroenterol. 23, 2870-2882.
    Pubmed KoreaMed CrossRef
  2. Ansari S and Yamaoka Y. 2017a. Helicobacter pylori BabA in adaptation for gastric colonization. World J. Gastroenterol. 23, 4158-4169.
    Pubmed KoreaMed CrossRef
  3. Ansari S and Yamaoka Y. 2017b. Survival of Helicobacter pylori in gastric acidic territory. Helicobacter 22, e12386.
    Pubmed KoreaMed CrossRef
  4. Ansari S and Yamaoka Y. 2019. Helicobacter pylori virulence factors exploiting gastric colonization and its pathogenicity. Toxins 11, 677.
    Pubmed KoreaMed CrossRef
  5. Benktander J, Barone A, Johansson MM, and Teneberg S. 2018. Helicobacter pylori SabA binding gangliosides of human stomach. Virulence 9, 738-751.
    Pubmed KoreaMed CrossRef
  6. Benoit SL, Seshadri S, Lamichhane-Khadka R, and Maier RJ. 2013. Helicobacter hepaticus NikR controls urease and hydrogenase activities via the NikABDE and HH0418 putative nickel import proteins. Microbiology 159, 136-146.
    Pubmed KoreaMed CrossRef
  7. Blum FC, Hu HQ, Servetas SL, Benoit SL, Maier RJ, Maroney MJ, and Merrell DS. 2017. Structure-function analyses of metal-binding sites of HypA reveal residues important for hydrogenase maturation in Helicobacter pylori. PLoS ONE 12, e0183260.
    Pubmed KoreaMed CrossRef
  8. Bugaytsova JA, Björnham O, Chernov YA, Gideonsson P, Henriksson S, Mendez M, Sjöström R, Mahdavi J, Shevtsova A, and Ilver DIlver D, et al. 2017. Helicobacter pylori adapts to chronic infection and gastric disease via pH-responsive BabA-mediated adherence. Cell Host Microbe 21, 376-389.
    Pubmed KoreaMed CrossRef
  9. Bui D, Brown HE, Harris RB, and Oren E. 2016. Serologic evidence for fecal-oral transmission of Helicobacter pylori. Am. J. Trop. Med. Hyg. 94, 82-88.
    Pubmed KoreaMed CrossRef
  10. Dunn BE, Cohen H, and Blaser MJ. 1997. Helicobacter pylori. Clin. Microbiol. Rev. 10, 720-741.
    Pubmed KoreaMed CrossRef
  11. Fagoonee S and Pellicano R. 2019. Helicobacter pylori: molecular basis for colonization and survival in gastric environment and resistance to antibiotics. A short review. Infect. Dis. 51, 399-408.
    Pubmed CrossRef
  12. Follmer C. 2010. Ureases as a target for the treatment of gastric and urinary infections. J. Clin. Pathol. 63, 424-430.
    Pubmed CrossRef
  13. Graham DY and Miftahussurur M. 2018. Helicobacter pylori urease for diagnosis of Helicobacter pylori infection: A mini review. J. Adv. Res. 13, 51-57.
    Pubmed KoreaMed CrossRef
  14. Gu H. 2017. Role of flagella in the pathogenesis of Helicobacter pylori. Curr. Microbiol. 74, 863-869.
    Pubmed KoreaMed CrossRef
  15. Hathroubi S, Servetas SL, Windham I, Merrell DS, and Ottemann KM. 2018a. Helicobacter pylori biofilm formation and its potential role in pathogenesis. Microbiol. Mol. Biol. Rev. 82, e00001-18.
    Pubmed KoreaMed CrossRef
  16. Hathroubi S, Zerebinski J, and Ottemann KM. 2018b. Helicobacter pylori biofilm involves a multigene stress-biased response, including a structural role for flagella. mBio 9, e01973-18.
    Pubmed KoreaMed CrossRef
  17. Hooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, Malfertheiner P, Graham DY, Wong VWS, and Wu JCYWu JCY, et al. 2017. Global prevalence of Helicobacter pylori infection: systematic review and meta-analysis. Gastroenterology 153, 420-429.
    Pubmed CrossRef
  18. Johnson KS and Ottemann KM. 2018. Colonization, localization, and inflammation: the roles of H. pylori chemotaxis in vivo. Curr. Opin. Microbiol. 41, 51-57.
    Pubmed KoreaMed CrossRef
  19. Kao CY, Sheu BS, and Wu JJ. 2016. Helicobacter pylori infection: an overview of bacterial virulence factors and pathogenesis. Biomed. J. 39, 14-23.
    Pubmed KoreaMed CrossRef
  20. Kusters JG, van Vliet AHM, and Kuipers EJ. 2006. Pathogenesis of Helicobacter pylori infection. Clin. Microbiol. Rev. 19, 449-490.
    Pubmed KoreaMed CrossRef
  21. Mamishi S, Eshaghi H, Mahmoudi S, Bahador A, Hosseinpour Sadeghi R, Najafi M, Farahmand F, Khodadad A, and Pourakbari B. 2016. Intrafamilial transmission of Helicobacter pylori: genotyping of faecal samples. Br. J. Biomed. Sci. 73, 38-43.
    Pubmed CrossRef
  22. Melese A, Genet C, Zeleke B, and Andualem T. 2019. Helicobacter pylori infections in Ethiopia; prevalence and associated factors: a systematic review and meta-analysis. BMC Gastroenterol. 19, 8.
    Pubmed KoreaMed CrossRef
  23. Mendoza-Cantú A, Urrutia-Baca VH, Urbina-Ríos CS, De la Garza-Ramos MA, García-Martínez ME, and Torre-Martínez HHH. 2017. Prevalence of Helicobacter pylori vacA genotypes and cagA gene in dental plaque of asymptomatic Mexican children. BioMed Res. Int. 2017, 4923640.
    Pubmed KoreaMed CrossRef
  24. Modolo LV, Modolo LV, de Souza AX, Horta LP, Araujo DP, and de Fátima Â. 2015. An overview on the potential of natural products as ureases inhibitors: a review. J. Adv. Res. 6, 35-44.
    Pubmed KoreaMed CrossRef
  25. Nakamura H, Yoshiyama H, Takeuchi H, Mizote T, Okita K, and Nakazawa T. 1998. Urease plays an important role in the chemotactic motility of Helicobacter pylori in a viscous environment. Infect. Immun. 66, 4832-4837.
    Pubmed KoreaMed CrossRef
  26. Ndip RN, MacKay WG, Farthing MJ, and Weaver LT. 2003. Culturing Helicobacter pylori from clinical specimens: review of microbiologic methods. J. Pediatr. Gastroenterol. Nutr. 36, 616-622.
    Pubmed CrossRef
  27. Olivera-Severo D, Uberti AF, Marques MS, Pinto MT, Gomez-Lazaro M, Figueiredo C, Leite M, and Carlini CR. 2017. A new role for Helicobacter pylori urease: contributions to angiogenesis. Front. Microbiol. 8, 1883.
    Pubmed KoreaMed CrossRef
  28. O'Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB, and Kolter R. 1999. Genetic approaches to study of biofilms. Methods Enzymol. 310, 91-109.
    Pubmed CrossRef
  29. Ottemann KM and Lowenthal AC. 2002. Helicobacter pylori uses motility for initial colonization and to attain robust infection. Infect. Immun. 70, 1984-1990.
    Pubmed KoreaMed CrossRef
  30. Ozbey G and Hanafiah A. 2017. Epidemiology, diagnosis, and risk factors of Helicobacter pylori infection in children. Euroasian J. Hepatogastroenterol. 7, 34-39.
    Pubmed KoreaMed CrossRef
  31. Rokbi B, Seguin D, Guy B, Mazarin V, Vidor E, Mion F, Cadoz M, and Quentin-Millet MJ. 2001. Assessment of Helicobacter pylori gene expression within mouse and human gastric mucosae by real-time reverse transcriptase PCR. Infect. Immun. 69, 4759-4766.
    Pubmed KoreaMed CrossRef
  32. Rolig AS, Shanks J, Carter JE, and Ottemann KM. 2012. Helicobacter pylori requires TlpD-driven chemotaxis to proliferate in the antrum. Infect. Immun. 80, 3713-3720.
    Pubmed KoreaMed CrossRef
  33. Scott DR, Weeks D, Hong C, Postius S, Melchers K, and Sachs G. 1998. The role of internal urease in acid resistance of Helicobacter pylori. Gastroenterology 114, 58-70.
    Pubmed CrossRef
  34. Singer M. 2010. Pathogen-pathogen interaction: a syndemic model of complex biosocial processes in disease. Virulence 1, 10-18.
    Pubmed KoreaMed CrossRef
  35. Valenzuela-Valderrama M, Cerda-Opazo P, Backert S, González MF, Carrasco-Véliz N, Jorquera-Cordero C, Wehinger S, Canales J, Bravo D, and Quest AFG. 2019. The Helicobacter pylori urease virulence factor is required for the induction of hypoxia-induced factor-1α in gastric cells. Cancers 11, 799.
    Pubmed KoreaMed CrossRef
  36. Wang W, Jiang W, Zhu S, Sun X, Li P, Liu K, Liu H, Gu J, and Zhang S. 2019. Assessment of prevalence and risk factors of Helicobacter pylori infection in an oilfield Community in Hebei, China. BMC Gastroenterol. 19, 186.
    Pubmed KoreaMed CrossRef
  37. Yılmaz N and Koruk Özer M. 2019. The prevalence of Helicobacter pylori babA, homB, aspA, and sabA genes and its relationship with clinical outcomes in Turkey. Can. J. Gastroenterol. Hepatol. 2019, 1271872.
    Pubmed KoreaMed CrossRef
  38. Yonezawa H, Osaki T, and Kamiya S. 2015. Biofilm formation by Helicobacter pylori and its involvement for antibiotic resistance. Biomed Res. Int. 2015, 914791.
    Pubmed KoreaMed CrossRef
  39. Young GM, Amid D, and Miller VL. 1996. A bifunctional urease enhances survival of pathogenic Yersinia enterocolitica and Morganella morganii at low pH. J. Bacteriol. 178, 6487-6495.
    Pubmed KoreaMed CrossRef
  40. Zhao Q, Song C, Wang K, Li D, Yang Y, Liu D, Wang L, Zhou N, and Xie Y. 2020. Prevalence of Helicobacter pylori babA, oipA, sabA, and homB genes in isolates from Chinese patients with different gastroduodenal diseases. Med. Microbiol. Immunol. 209, 565-577.
    Pubmed CrossRef


June 2021, 57 (2)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information