search for




 

Enhancement of antibody-mediated botulinum toxin A neutralization by conjugating annexin V to the antibody in the mouse model
Korean J. Microbiol. 2021;57(3):169-173
Published online September 30, 2021
© 2021 The Microbiological Society of Korea.

Eun Sun Choi, Jun Ho Jeon, Yu-Ri Kim, Yeon Hee Kim, Kiweon Cha*,#, and Gi-eun Rhie*

Division of High-risk Pathogens, Bureau of Infectious Disease Diagnosis Control, Korea Disease Control and Prevention Agency, Cheongju 28159, Republic of Korea
#Present Address: New Drug Development Center, KbioHealth, Cheongju 28160, Republic of Korea
Correspondence to: (K. Cha) E-mail: kwcha@kbiohealth.kr; Tel.: +82-43-200-9510; Fax: +82-43-200-9529 /
(G. Rhie) E-mail: gerhie@korea.kr; Tel.: +82-43-719-8270; Fax: +82-43-719-8309
These authors contributed equally to this work.
Received June 3, 2021; Revised July 13, 2021; Accepted July 14, 2021.
Abstract
Botulism is a neuroparalytic illness caused by the exotoxin of Clostridium botulinum. Although equine antitoxin or human immunoglobulin has been used for the treatment of botulism, development of a new antibody therapeutics is required to minimize side effects. We designed an apoptotic cell-targeting protein complex to link Annexin V to Phosphatidylserine (PS) on the host’s apoptotic cells to enhance Botulinum Toxin (BoNT) neutralization. The apoptotic cell-targeting protein complex is composed of biotinylated H9-6 antibody (bH9-6) that specifically binds to heavy chain of BoNT/A and Streptavidin-Linker-fused Annexin V protein (StAv-L-Annexin V) that targets the PS of host’s apoptotic cells. In the mouse model, bH9-6-StAv-L-Annexin V complex completely protected mice against 5 LD50 of BoNT/A, whereas the bH9-6 antibody-treated group did not show any neutralizing ability. These results suggest that bH9-6-StAv-L-Annexin V complex might enhance BoNT/A neutralization by binding to apoptotic cells. Further study is required to clarify the exact clearance mechanism.
Keywords : antibody, annexin V, botulism, botulinum toxin A, neutralization
Body

자연사멸(Apoptosis)은 다양한 생리학 및 병리학적 과정에 관여하는 프로그램 된 세포사멸로 외인성 및 내인성 인자 모두에 의해 유발될 수 있는 매우 복잡한 세포 현상이다(Krampe and Al-Rubeai, 2010). 여러 요인에 의한 사멸 신호는 세포 안쪽 막에 존재하는 Phosphatidylserine (PS)을 바깥 막 쪽으로 이동하게 한다(Koopman et al., 1994). Phosphatidylserine (PS)는 정상세포에서 잘 발견되지 않는 자연사멸세포(Apoptotic Cells)의 특이적 마커로 작용하며 Annexin V가 우선적으로 결합하여 초기의 세포사멸을 신속하게 감지한다. Annexin V 결합분석은 자연사멸세포를 검출하는 황금 표준방법(Gold Standard Method)으로써, 최근 형광을 결합시킨 Annexin V를 이용하여 세포사멸반응을 in vivo에서 실시간으로 관찰하는데 사용된 바 있다(Gelles and Chipuk, 2016).

보툴리눔 독소(BoNT)는 현재 A~G 7개의 독소형이 알려져 있으며, 이중 A, B, E, F형은 사람에게 보툴리눔 독소증을 유발한다(Coffield et al., 1997). 미국 보건부에서는 맹독성인 보툴리눔 독소를 Tier1 biological select agents and toxins 중 하나로 지정하고 있다(Morse, 2015). 보툴리눔 독소증은 유입 경로에 따라서 식품 매개, 영아, 상처 유래, 의인형 및 흡인형으로 나눌 수 있고(Hakami et al., 2010; Sepulveda et al., 2010) 전 세계적으로 드물게 발생하여 정확한 집계는 알려져 있지 않지만 2017년 미국의 경우, 총 182건 발생 중 영아 77%, 식품매개 10%, 상처유래 10%, 기타 1%의 보툴리눔 독소증이 확인되었다(CDC, 2017). 현재까지 보툴리눔 독소증 치료를 위해 승인된 제품은 말에 톡소이드(A/B/E 3가 또는 A/B/C/D/E/F/G 7가) 백신을 접종한 후 분리된 항체를 이용하여 생산된 마항독소를 일반적으로 사용하고 있고(Dembek et al., 2011), 보툴리눔 독소를 불활성화 시킨 5가 톡소이드(A/B/C/D/E) 백신을 접종한 성인 공여자의 혈청으로부터 분리한 면역글로블린 치료제(Big-IV)는 2003년 미국 FDA의 승인을 받아 A, B형 영아 보툴리눔 독소증에 제한적으로 사용되고 있다(Long et al., 2007). 그러나 이종단백질인 마항독소에 의해 혈청병이 발생하거나, 다클론항체인 면역글로블린 치료제의 반복투여로 인해 부작용이 발생할 수 있기 때문에 이를 최소화하기 위한 연구가 필요한 실정이다(Sepulveda et al., 2010). 따라서 본 연구진은 보툴리눔 독소 A (BoNT/A)의 중쇄 카르복실 말단을 특이적으로 인식하는 단클론항체 H9-6과 자연사멸세포의 PS에 결합하는 표적 단백질 Annexin V를 Streptavidin (StAv)-Biotin (b) 시스템으로 항체-단백질 복합체를 형성하고 이 복합체가 생체 내에 자연사멸세포와 결합하여 대식세포 등에 의하여 제거되어 효과적으로 보툴리눔 독소 A의 중화능이 증가할 수 있는 방법을 고안하였다(Fig. 1).

Fig. 1. Schematic representation of the apoptotic cell-targeting protein complex. The protein complex is composed of biotinylated antibody that binds to heavy chain of BoNT/A and Streptavidin-Linker-Annexin V (StAv-L-Annexin V) that binds to Phosphatidylserine (PS) on the surface of apoptotic cells.

먼저 보툴리눔 독소 A의 중쇄 카르복실 말단(NCBI Reference Sequence_009697.1; 861–1296 nts) 유전자를 중합효소 연쇄 반응(Polymerase Chain Reaction, PCR)을 이용하여 5’ Nde I-F1 Primer (CATATGCGCTTGCTGAGCACCTTTACCG)와 3’BamHI-R1 Primer (CACCCCACTTGCCGGAGACCC GCCACCGCTCGAG)로 증폭시킨 후 pET19b 발현 벡터에 클로닝하여 Escherichia coli BL21 (DE3) RIPL 균주에 형질전환 시켰다. 발현된 재조합 중쇄 카르복실 말단 보툴리눔 독소 A (rHccA)는 Nickel-Nitrilotriacetic Acid (Ni-NTA) Agarose Column Chromatography로 정제하였고, 정제 단백질을 마우스에 면역하여 다양한 단클론항체를 제작하였다(GW Vitech). 효소면역측정법(Enzyme-Linked Immunosorbent Assay, ELISA)을 통하여 최종 선별된 H9-6 단클론항체 세포주를 5주령, 암컷 BALB/c 마우스의 복강에 주입 후, 복수를 채취하였고 Protein G Agarose Bead Column을 이용해 H9-6 단클론항체를 확보하였다. rHccA 항원과 H9-6 단클론항체의 결합력은 효소면역측정법 실험을 통해 확인하였다. 96-Well Plate에 rHccA 항원을 Well당 500 ng씩 4°C에서 16시간 coating 후, 단클론항체 H9-6을 100 nM에서 3배씩 계단 희석하여 반응시키고 이차 항체인 Anti-Mouse-HRP (1:2,000)와 결합시킨 다음 Phosphatidyl Choline 버퍼에 o-Phenylenediamine Dihydrochloride를 혼합한 기질용액으로 발색시켜 흡광도 490 nm에서 측정하였고 GraphPad Prism® 소프트웨어를 이용하여 Kd 값을 산출하였다. 그 결과 H9-6 항체와 rHccA 항원은 0.85 × 10-9 M의 값으로 높은 결합력을 나타냈다(Fig. 2A). 같은 조건의 실험에서 보툴리눔 독소 A Complex (Medytox)와 H9-6 항체의 결합력은 1.41 × 10-9 M 값으로 확인되었다(자료 미제시). 보툴리눔 독소 A Complex와 H9-6 항체의 항원-항체 결합반응을 확인하기 위해 먼저 보툴리눔 독소 A Complex 30 µg을 Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) 분석법으로 분리 후, Coomassie Brilliant Blue (CBB) (Thermo)로 겔을 염색하여 보툴리눔 독소 A Complex를 구성하고 있는 단백질을 확인하였다(Fig. 2B, Lane 2). 그 다음 Western Blot 분석법을 이용하여 보툴리눔 독소 A의 중쇄와 H9-6 항체의 결합반응을 확인하였다(Fig. 2B, Lane 3). 보툴리눔 독소 A complex 30 µg을 12% SDS 겔에 전기 영동 후, 겔은 Polyvinylidene Fluoride (PVDF) Membrane (Thermo)에 이동시켜 1차 항체 H9-6 2 µg과 2차 항체 Anti-Mouse-HRP (1:5,000)로 반응시키고 Enhanced Chemiluminescence 기질용액(Thermo)으로 발색하였다. 실험 결과 보툴리눔 독소 A complex의 100 kDa 중쇄에 H9-6 항체가 결합하는 것을 확인하였다.

Fig. 2. Binding of H9-6 mAb to BoNT/A heavy chain. (A) For ELISA analysis, microtiter plate was coated with 5 mg/ml of rHccA followed by detection with various concentrations of H9-6 mAb. The Kd value was calculated by the GraphPad Prism® software. (B) Thirty microgram of BoNT/A complex was separated by SDS-PAGE. The gel was stained either with CBB or probed with H9-6 mAb after transferring to PVDF membrane. The indicated bands showed BoNT/A (heavy chain and light chain), Nontoxic Non-Hemagglutinin (NTNHA), and Hemagglutinins (HA-70, HA-33, and HA-17). Lanes: 1, Molecular weight markers; 2, BoNT/A complex; 3, H9-6 mAb binding to BoNT/A complex on the Western Blot.

그 다음 보툴리눔 독소 A에 대한 H9-6 항체의 중화능을 확인하기 위해 마우스 실험을 수행하였다. 모든 마우스 실험은 질병관리청의 동물실험윤리위원회 심의 승인 후 수행되었다(IACUC, KCDC-173-14-2A). 5 LD50 보툴리눔 독소 A와 0.1, 0.5, 1, 2.5 mg의 H9-6 항체를 각각 혼합하여 200 ml씩 마우스 복강 내에 투여 후 5일 동안 중화능을 관찰한 결과, 보툴리눔 독소 A와 함께 2.5 mg의 H9-6 항체를 주사한 마우스는 100% 생존 확인하였지만 1 mg의 항체를 주사한 마우스는 50% 생존율을 보였고, 0.5 mg 이하의 H9-6 항체를 주사한 마우스의 경우 생존기간은 연장되었으나 모두 폐사하였다(자료 미제시). 이 결과를 통하여 H9-6 단클론항체가 마우스에서 보툴리눔 독소 A에 대해 어느 정도 중화능을 보유하고 있는 것을 확인하였고, 이를 바탕으로 본 연구진은 보툴리눔 독소 A 공격으로부터 생존기간을 연장할 수 있는 최소한의 항체량을 이용하여 중화능 증가여부를 시험하고자 0.5 mg의 H9-6 항체를 실험에 사용하였다.

Streptavidin-Biotin 결합의 원리를 이용하여(Diamandis et al., 1991) 항체-단백질 복합체를 형성하기 위해 먼저, 단클론항체 H9-6에 Biotinylation Kit (Thermo)를 이용하여 Biotin을 1:2 (1 mmol Antibody : 2 mmol Biotin)의 비율로 부착하여 bH9-6을 제조하였다. Annexin V 유전자(NCBI Reference Sequence_ 001009099.1; 963 nts)는 중합효소 연쇄 반응을 통해 5’ Nde I-F1 Primer (aatcatATGGCTGAAGCTGGTATCACAGG)와 3’BamHI-R1 Primer (aatggatccTTAGTCATCTTCTCCACA GAGCAGC)로 증폭시킨 후 StAv 유전자의 3’말단에 접합하여 pET19b 발현 벡터에 클로닝 하였다. 이때 발현된 각 단백질의 3차 구조 형성에 영향을 미치지 않도록 StAv과 Annexin V 사이에 Linker 서열인 (GGGGS)4 아미노산을 첨가하였다. 단백질 발현을 위해 pET19b-StAv-Linker-Annexin V 발현 벡터를 E. coli BL21 (DE3) pLysS에 형질전환 후, Ni-NTA Column을 이용해 단백질을 정제하였다(StAv-L-Annexin V). 정제된 단백질 StAv-L-Annexin V가 자연사멸세포 특이적으로 결합하는지 확인하기 위해 골수 유래 대식 세포(Bone-Marrow-Derived Marcrophages, BMDMs)에 자연사멸을 유도한 후 FITC가 결합된 StAv-L-Annexin V를 세포 배양액에 넣어 공초점 현미경으로 분석하였고, 그 결과 이전에 보고된 연구(Kim et al., 2015)와 같이 StAv-L-Annexin V가 자연사멸세포 특이적으로 결합됨을 확인하였다(자료 미제시). 이와 같은 결과를 바탕으로 bH9-6항체와 StAv-L-Annexin V를 혼합한 복합체 또한 자연사멸세포 특이적으로 결합할 것으로 예상하였다. 그 다음 마우스 모델에서 bH9-6-StAv-L-Annexin V 복합체를 이용하여 보툴리눔 독소 A에 대한 중화능을 확인하였다. bH9-6 항체 0.5 mg과 StAv-L-Annexin V 30 mg 그리고 5 LD50 보툴리눔 독소 A와 함께 혼합하여 마우스 당 200 ml씩 그룹당 6마리에 복강 내 투여 후 5일 동안 관찰하였다. 실험결과, 5 LD50 보툴리눔 독소 A와 bH9-6 항체만 혼합하여 주사한 마우스 그룹은 3일 안에 모두 폐사하였지만, StAv-L-Annexin V가 혼합된 복합체를 주사한 마우스 그룹에서는 5일 동안 6마리 모두 생존하는 것을 확인하였다(Table 1). 이 결과는 마우스 생체 내에 StAv-L-Annexin V와 bH9-6 항체 복합체(bH9-6-StAv-L-Annexin V)가 보툴리눔 독소 A의 중화능을 증가시킨다는 것을 보여준다.

Neutralization of BoNT/A by bH9-6-StAv-L-Annexin V complex in the mouse model

Group bH9-6 mAb (μg/mouse) StAv-L-Annexin V (μg/mouse) Surviving mice after 5 days of injection (% of survival, n = 6)
1 - - 0
2 0.5 - 0
3 0.5 30 100


보툴리눔 독소 A가 단클론항체 또는 복합체에 의해 중화되는 메커니즘은 잘 알려져 있지 않지만, 이전 연구에서 설치류 동물에 보툴리눔 독소 A와 중쇄의 카르복실기 말단에 결합하는 중화항체를 투여한 결과, 혈액 순환과정을 통해 독소가 제거되고 간과 비장에 축적되는 것을 확인하였다(Ravichandran et al., 2006). 또한 적혈구 표면 Glycophorin A에 결합하는 부분항체와 보툴리눔 독소 A 중쇄에 특이적인 단클론항체를 StAv-Biotin 결합방법으로 복합체를 형성하고 이를 마우스에 투여한 결과, 마우스 혈액에서 보툴리눔 독소 A의 농도가 감소되었고 중화능이 증가되는 연구결과가 보고 되었다(Adekar et al., 2011).

자연사멸세포가 생체 내에서 과도하게 발생하면 자가면역 또는 만성염증질환이 발생할 수 있기 때문에 유해한 물질이 방출되기 전 자연사멸세포를 효율적으로 제거하는 것이 중요하다(Hagimoto et al., 1997). 따라서 이를 제거하기 위해 자연사멸세포 표면의 PS는 대식세포가 인식하는데 중요한 결정 인자로 알려져 있다(Fadok et al., 2000). 본 연구진은 Fig. 1에 모식화된 것과 같이 자연사멸세포의 PS를 표적으로 하는 단백질 Annexin V를 이용하여 StAv-Biotin 결합으로 단클론항체 H9-6을 연결하였고, 대식세포가 자연사멸세포와 보툴리눔 독소 A를 동시에 제거함으로써 보툴리눔 독소 A 중화능을 증가시킬 것으로 기대하였다. 본 연구결과에서 bH9-6-StAv-L-Annexin V 복합체는 마우스 생체 내에서 bH9-6 단클론항체 단독과 비교하여 보툴리눔 독소 A에 대한 중화능을 증가시킴을 확인하였다. 따라서 StAv-Biotin 결합으로 강력하게 연결된 bH9-6-StAv-L-Annexin V 복합체는 생체 내에서 안정적으로 작용하며, 보툴리눔 독소 A에 대하여 중화능을 증가시키는 촉진제 역할을 하였다고 사료된다. 또한 이 복합체는 적은 양의 bH9-6 단클론항체를 사용하였기 때문에 기존의 다클론항체를 이용한 보툴리눔 독소증 치료제의 부작용을 줄일 수 있고, 새로운 치료제 개발에 도움이 될 것으로 기대한다. 향후 bH9-6-StAv-L-Annexin V 복합체가 자연사멸세포와 결합한 후 대식세포 등에 의해 제거되는 기전에 대한 추가 연구가 필요할 것으로 사료된다.

적 요

보툴리눔 독소증은 Clostridium botulinum균의 외독소에 의한 신경 마비성 질환으로 치료를 위해서 마항독소 또는 면역글로블린이 사용되고 있지만, 부작용 등을 최소화하기 위한 새로운 항체 치료제 개발이 필요하다. 본 연구에서는 보툴리눔 독소 A 중쇄에 특이적으로 결합하는 H9-6 단클론항체와 숙주의 자연사멸세포를 표적으로 하는 Annexin V 단백질을 연결하여 복합체(bH9-6-StAv-L-Annexin V)를 형성하였고 보툴리눔 독소 A와 함께 마우스에 투여 후 중화능을 평가하였다. 그 결과 마우스 모델에서 bH9-6 단클론항체를 단독으로 투여한 경우 5 LD50의 보툴리눔 독소 A에 대한 중화능은 보이지 않은 반면 bH9-6-StAv-L-Annexin V 복합체를 주사한 마우스는 모두 생존하는 것을 확인하였다. 이와 같은 결과는 bH9-6-StAv-L-Annexin V 복합체가 자연사멸세포에 결합함으로써 보툴리눔 독소 A에 대한 중화능을 증가시킬 수 있음을 시사한다. 향후 정확한 제거 기전을 규명하기 위한 추가 연구가 필요할 것으로 사료된다.

Acknowledgments

본 연구는 질병관리청 연구개발과제(2013-NI45001-00) 연구비를 지원받아 수행되었다.

Conflict of Interest

The authors have no conflicts of interest to report.

Ethical Statement

모든 마우스 실험은 질병관리청의 동물실험윤리위원회 심의 승인 후 수행되었다(IACUC, KCDC-173-14-2A).

References
  1. Adekar SP, Segan AT, Chen C, Bermudez R, Elias MD, Selling BH, Kapadnis BP, Simpson LL, Simon PM, and Dessain SK. 2011. Enhanced neutralization potency of botulinum neurotoxin antibodies using a red blood cell-targeting fusion protein. PLoS ONE 6, e17491.
    Pubmed KoreaMed CrossRef
  2. Centers for Disease Control and Prevention (CDC). Botulism annual summary, . Page last reviewed: Jan 15, 2020. cdc.gov/botulism/surv/2017/index.html.
  3. Coffield JA, Bakry N, Zhang RD, Carlson J, Gomella LG, and Simpson LL. 1997. In vitro characterization of botulinum toxin types A, C and D action on human tissues: combined electrophysiologic, pharmacologic and molecular biologic approaches. J. Pharmacol. Exp. Ther. 280, 1489-1498.
    Pubmed
  4. Dembek ZF. Medical Management of Biological Casualties Handbook. 7th edn. United States Army Medical Research Institute of Infectious Disease, Fort Detrick, Maryland, USA. ISBN 978-0-16-090015-0.
  5. Diamandis EP and Christopoulos TK. 1991. The biotin-(strept)avidin system principles and applications in biotechnology. Clin. Chem. 37, 625-636.
    Pubmed CrossRef
  6. Fadok VA, Bratton DL, Rose DM, Pearson A, Ezekewitz RAB, and Henson PM. 2000. A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature 405, 85-90.
    Pubmed CrossRef
  7. Gelles JD and Chipuk JE. 2016. Robust high-throughput kinetic analysis of apoptosis with real-time high-content live-cell imaging. Cell Death Dis. 7, e2493.
    Pubmed KoreaMed CrossRef
  8. Hagimoto N, Kuwano K, Miyazaki H, Kunitake R, Fujuti M, Kawasaki M, Kaneko Y, and Hara N. 1997. Induction of apoptosis and pulmonary fibrosis in mice in response to ligation of Fas antigen. Am. J. Respir. Cell Mol. Biol. 17, 272-278.
    Pubmed CrossRef
  9. Hakami RM, Ruthel G, Stahl AM, and Bavari S. 2010. Gaining ground: assays for therapeutics against botulinum neurotoxin. Trends Microbiol. 18, 164-172.
    Pubmed CrossRef
  10. Kim S, Bae SM, Seo J, Cha K, Piao M, Kim SJ, Son HN, Park RW, Lee BH, and Kim IS. 2015. Advantages of the phosphatidylserine-recognizing peptide PSP1 for molecular imaging of tumor apoptosis compared with Annexin V. PLoS ONE 10, e0121171.
    Pubmed KoreaMed CrossRef
  11. Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST, and van Oers MM. 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 84, 1415-1420.
    Pubmed CrossRef
  12. Krampe B and Al-Rubeai M. 2010. Cell death in mammalian cell culture: molecular mechanisms and cell line engineering strategies. Cytotechnology 62, 175-188.
    Pubmed KoreaMed CrossRef
  13. Long SS. 2007. Long infant botulism and treatment with BIG-IV (BabyBIG). Pediatr. Infect. Dis. J. 26, 261-262.
    Pubmed CrossRef
  14. Morse SA. 2015. Pathogen security-help or hindrance?. Front. Bioeng. Biotechnol. 2, 83.
    Pubmed KoreaMed CrossRef
  15. Ravichandran E, Gong Y, Al Saleem FH, Ancharski DM, Joshi SG, and Simpson LL. 2006. An initial assessment of the systemic pharmacokinetics of botulinum toxin. J. Pharmacol. Exp. Ther. 318, 1345-1351.
    Pubmed CrossRef
  16. Sepulveda J, Mukherjee J, Tzipori S, Simpson LL, and Shoemaker CB. 2010. Efficient serum clearance of botulinum neurotoxin achieved using a pool of small antitoxin binding agents. Infect. Immun. 78, 756-763.
    Pubmed KoreaMed CrossRef


September 2021, 57 (3)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information

Funding Information