search for




 

Genome sequence analysis of the oligosaccharide-producing strain Leuconostoc lactis SBC001
Korean J. Microbiol. 2021;57(4):286-288
Published online December 31, 2021
© 2021 The Microbiological Society of Korea.

Jisun Park1, Sulhee Lee2, and Young-Seo Park1*

1Department of Food Science and Biotechnology, Gachon University, Seongnam 13120, Republic of Korea
2Microbiology and Functionality Research Group, World Institute of Kimchi, Gwangju 61755, Republic of Korea
Correspondence to: E-mail: ypark@gachon.ac.kr;
Tel.: +82-31-750-5378; Fax: +82-31-750-5389
Received September 29, 2021; Revised October 31, 2021; Accepted November 4, 2021.
Abstract
Genome sequencing was conducted to identify the genetic characteristics of Leuconostoc lactis SBC001 isolated from garlic chive. The genome assembly showed three contigs, and the genome size was 1,835,155 bp with 43.1% GC content. Furthermore, genome annotation showed that the genome included 1,689 protein-coding genes, 12 rRNA genes, 67 tRNA genes, three ncRNA genes, and 45 pseudogenes. Leuconostoc lactis SBC001 and 24 L. lactis strains were close, with average nucleotide identity values ranging from a minimum of 93.96% (strain WiKim21) to a maximum of 98.49% (strain UBA5566). Additionally, L. lactis SBC001 has various oligosaccharide- synthesizing genes, such as genes encoding glycosyltransferase, dextransucrase, maltose phosphorylase, and β-galactosidase.
Keywords : Leuconostoc lactis, dextransucrase, draft genome sequence, lactic acid bacteria, oligosaccharides
Body

Leuconostoc species are non-motile, Gram-positive, facultatively anaerobic, and catalase-negative microorganisms with 37–45 mol% GC content (Oh et al., 2019). These lactic acid bacterial species prevent pathogens that cause various diseases. Additionally, many studies have shown that some lactic acid bacteria, such as Leuconostoc, Streptococcus, Lactobacillus, Weissella, and Oenococcuss strains, produce oligosaccharides (Morales-Arrieta et al., 2006). Oligosaccharides are synthesized by the action of glycosyltransferases that use disaccharides, such as maltose and sucrose, as acceptor and donor molecules, respectively. Some oligosaccharides can be used as prebiotics to stimulate the metabolic activity and growth of bacterial strains that have beneficial health effects on their host (Mussatto and Mancilha, 2007).

Leuconostoc lactis SBC001, which produces oligosaccharides in good yield, was isolated from garlic chive (Allium tuberosum). Genomic DNA of L. lactis SBC001 was extracted using AccuPrep Genomic DNA Extraction kit (Bioneer), and the draft genome was sequenced at Macrogen Inc. using the PacBio single-molecule real-time platforms. Additionally, de novo assembly was performed using the hierarchical genome assembly process. Genome annotation was performed using the NCBI (National Center for Biotechnology Information) prokaryotic genome annotation pipeline. The annotation of the predicted genes was achieved using rapid annotations using subsystems technology server (Aziz et al., 2008) and eggNOG v.5.0 (Huerta-Cepas et al., 2019) for clusters of orthologous group (COG) categories. Additionally, average nucleotide identity (ANI) values were calculated as described by Rodriguez-R and Konstantinidis (2016). Protein sequences for carbohydrate-active enzymes (CAZymes) were identified by searching sequences against annotated Hidden Markov Model (HMM) profiles of CAZyme proteins (dbCAN HMMs 5.0) acquired from the dbCAN database using the hmmscan tool (Yin et al., 2012).

The genome features of L. lactis SBC001 are summarized in Table 1. The draft genome of L. lactis SBC001 was 1,835,155 bp (three contigs; contig N50 1,758,110 bp) in size with a GC content of 43.1%. Furthermore, the genome contained 1,689 protein-coding genes, 67 tRNA genes, 12 rRNA genes (5S, 16S, and 23S), three ncRNA genes, and 45 pseudogenes. ANI values were calculated in 25 species of L. lactis; strain SBC001 and UBA5566 were the most similar in ANI value at 98.49%. ANI values of L. lactis strains were 93–99%, demonstrating that they were inaccurate for comparing the subspecies. Additionally, the ANI value showed the proposed cutoff for species boundary to be 95–96% (Richter and Rosselló-Móra, 2009). A total of 1,816 genes were functionally assigned to categories based on COG assignments. In L. lactis SBC001’s genome, the number of genes associated with general function prediction (R; 331 ORF, 9.5%), translation, ribosomal structure and biogenesis (J; 278 ORF, 8.0%), and carbohydrate transport and metabolism (G; 263 ORF, 7.6%) were more than that associated with other functions. Additionally, 18 and 25 CRISPR (clustered regularly interspaced short palindromic repeats) spacers were predicted by CRISPRfiner (Grissa et al., 2007), and the direct repeats, GTACTTGAACTTATTGATTTAACACTCTTCTGAAAC (36 bp) and GCTTCAGATGTCTGTCATTTTAATGAGTTC GAGTAC (36 bp), were found. Furthermore, genome annotation and functional characterization analysis showed that the draft genome sequence of L. lactis SBC001 contained multiple genes encoding putative polysaccharides- or oligosaccharides-producing enzymes, including glycosyltransferase (EC 2.4.1.7), β-galactosidase (EC 3.2.1.23), maltose phosphorylase (EC 2.4.1.8), and dextransucrase (EC 2.4.1.5). Thus, these results indicate that L. lactis SBC001 synthesizes polysaccharides or oligosaccharides via an acceptor–donor reaction of glycosyltransferase. Gluco-oligosaccharides produced from L. lactis SBC001 could be used as alternative prebiotics to inulin or fructo-oligosaccharides (Kim et al., 2021).

Genome features of strain SBC001

Genome features Value
Genome size (bp) 1,835,155
No. of contigs 3
G + C content (%) 43.1
Protein-coding genes 1,689
tRNA genes 67
rRNA genes (5S, 16S, 23S) 12 (4, 4, 4)
Non-coding RNA genes 3
Pseudo genes 45
GenBank Accession No. NZ_JACGAK000000000


Nucleotide sequence accession number

The draft genome of Leuconostoc lactis SBC001 has been deposited at GenBank under the accession number NZ_JACG AK000000000. Leuconostoc lactis SBC001 was deposited in Korean Culture Center of Microorganisms under the deposit number KCCM 43403.

적 요

본 연구에서는 부추에서 분리한 Leuconostoc lactis SBC001의 유전체 염기서열 해독을 PacBio SMRT platform을 사용하여 수행하였다. 그 결과, 유전체의 길이는 1,835,155 bp, G + C 함량은 43.1%로 구성되었다. 전체 단백질 암호화 유전자 1,689개, 12개의 rRNA 유전자, 67개의 tRNA 유전자, 3개의 ncRNA, 45개의 pseudo 유전자가 확인되었다. ANI 분석에 따른 L. lactis SBC001과 유사도가 가장 높은 균주는 L. lactis UBA5566 (98.49%)로 확인되었고, 여러 탄수화물 분해 및 합성 효소를 보유하고 있으며, 특히 올리고당 합성에 관여하는 glycosyltransferase (EC 2.4.1.7), β-galactosidase (EC 3.2.1.23), maltose phosphorylase (EC 2.4.1.8)와 dextransucrase (EC 2.4.1.5) 효소를 지니고 있었다.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2019R1A2C1004950).

Conflict of Interest

The authors have no conflict of interest to report.

References
  1. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S, Glass EM, and Kubal MKubal M, et al. 2008. The RAST server: rapid annotations using subsystems technology. BMC Genomics 9, 75.
    Pubmed KoreaMed CrossRef
  2. Grissa I, Vergnaud G, and Pourcel C. 2007. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 35, W52-W57.
    Pubmed KoreaMed CrossRef
  3. Huerta-Cepas J, Szklarczyk D, Heller D, Hernández-Plaza A, Forslund SK, Cook H, Mende DR, Letunic I, Rattei T, and Jensen LJJensen LJ, et al. 2019. eggNOG 5.0: a hierarchical, functionally and phylogenetically annotated orthology resource based on 5090 organisms and 2502 viruses. Nucleic Acids Res. 47, D309-D314.
    Pubmed KoreaMed CrossRef
  4. Kim M, Jang JK, and Park YS. 2021. Production optimization, structural analysis, and prebiotic- and anti-inflammatory effects of gluco-oligosaccharides produced by Leuconostoc lactis SBC001. Microorganisms 9, 200.
    Pubmed KoreaMed CrossRef
  5. Morales-Arrieta S, Rodríguez ME, Segovia L, López-Munguía A, and Olvera-Carranza CJG. 2006. Identification and functional characterization of levS, a gene encoding for a levansucrase from Leuconostoc mesenteroides NRRL B-512 F. Gene 376, 59-67.
    Pubmed CrossRef
  6. Mussatto SI and Mancilha IM. 2007. Non-digestible oligosaccharides: a review. Carbohydr. Polym. 68, 587-597.
  7. Oh YJ, Kim JY, Park HK, Jang JY, Lim SK, Kwon MS, and Choi HJ. 2019. Salicibibacter halophilus sp. nov., a moderately halophilic bacterium isolated from kimchi. J. Microbiol. 57, 997-1002.
    Pubmed CrossRef
  8. Richter M and Rosselló-Móra R. 2009. Shifting the genomic gold standard for the prokaryotic species definition. Proc. Natl. Acad. Sci. USA 106, 19126-19131.
    Pubmed KoreaMed CrossRef
  9. Rodriguez-R LM and Konstantinidis KT. 2016. The enveomics collection: a toolbox for specialized analyses of microbial genomes and metagenomes. PeerJ Prepr. 4, e1900v1.
  10. Yin Y, Mao X, Yang J, Chen X, Mao F, and Xu Y. 2012. dbCAN: a web resource for automated carbohydrate-active enzyme annotation. Nucleic Acids Res. 40, W445-W451.
    Pubmed KoreaMed CrossRef


December 2021, 57 (4)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information

Funding Information