search for




 

Complete genome sequence of Cherry virus A identified from sweet cherry in Korea
Korean J. Microbiol. 2022;58(1):58-60
Published online March 31, 2022
© 2022 The Microbiological Society of Korea.

Da Hyun Lee, Young Ho Jung, JunHyeok Kim, Hyeon Min Kim, Kyeong Min Kim, Chaesun Na, and Chung Youl Park*

Division of Wild Plant Seeds Research, Baekdudaegan National Arboretum, Bonghwa 35208, Republic of Korea
Correspondence to: E-mail: doonas@koagi.or.kr; Tel.: +82-54-679-0691; Fax: +82-54-679-0690
Received March 2, 2022; Revised March 28, 2022; Accepted March 30, 2022.
Abstract
Sweet cherry (Prunus avium L.) is a non-climacteric plant that belongs to the Rosaceae family. The aim of the present study was to sequence the complete genome of cherry virus A (CVA) from sweet cherries grown in Daegu, Korea. The complete genome of the CVA isolate DG-FC9 was 7,434 nucleotides (nt) in length and encoded a polyprotein and movement protein. The genome sequence shared the highest nt sequence identity (99.26%) with that of the CVA isolate Niagara-B1. To our knowledge, this is the first complete CVA genome sequence to be reported from sweet cherry in Korea.
Keywords : Cherry virus A, complete genome, sweet cherry, virus
Body

The cherry virus A (CVA; family Betaflexiviridae, genus Capillovirus, species Cherry virus A) isolated from sweet cherries (Prunus avium) was first reported in 1995 in South Germany (Jelkmann, 1995; Noorani et al., 2010). Members of the genus Capillovirus, contain flexuous filamentous particles with a positive-sense, single-stranded linear RNA genome (Koinuma et al., 2016). The RNA genome of capilloviruses consists of two open reading frames (ORFs), one encoding a large polyprotein with conserved domains (methyltransferase, RNA helicase, RNA-dependent RNA polymerase, and coat protein) and another encoding a movement protein (Yoshikawa et al., 1992; James and Jelkmann, 1998; Tatineni et al., 2009). CVA has been isolated from several Prunus species, including P. armeniaca, P. cerasifera, and P. mume, and has been detected globally (Svanella-Dumas et al., 2005; Kinoti et al., 2016; Jo et al., 2017). Partial sequences of CVA isolates from sweet cherry have been reported (GenBank accession numbers MF083703 and MF083703). However, the complete genome sequence of an isolate from Korea has not yet to be reported.

In May 2018, sweet cherry leaves that exhibited mosaic and malformation symptoms were collected from Daegu, Korea. To identify the virus responsible for the disease symptoms, total RNA was extracted from the leaf samples using a NucliSENS easy-Mag BioRobot system (bioMérieux), and ribosomal RNA was removed using the Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s instructions. A RNA library was then generated using the TruSeq RNA Sample Prep kit (Illumina), and high-throughput RNA sequencing was performed by Theragen BIO, Inc. using a 101-bp paired-end Illumina HiSeq 2500 (Illumina). The resulting 324,893,846 RNA sequencing reads were mapped using SG-VIPdb by SeqGenesis to identify virus-related contigs. Low-quality reads (PHRED score ≤ 25, length ≤ 20 nt) were removed before data analyses, and de novo assembly of the quality-filtered reads was performed using the Trinity (v.2.1.1) pipeline. The six resulting contigs were analyzed using the NCBI BLAST algorithm searches against viral reference genome database in GenBank for 89.9–100% sequence identity to CVA isolates PF and HPSK25 (GenBank accession numbers HQ267856 and FR718888, respectively). To sequence the complete genome of the new isolate from sweet cherry, six primer pairs were designed using the complete genome sequence of CVA isolate Niagara-B1 and used for both reverse transcription PCR and cDNA sequencing (Table 1). The 5'- and 3'-terminal end sequences of the cDNAs were determined via rapid amplification, as described previously (Park et al., 2016). The eight resulting amplicons were cloned into a TA cloning vector (RBC Bioscience), and 64 clones (eight clones for each amplicon) were sequenced using the Sanger method by Macrogen, Inc.

Primers used to sequence the complete genome of the Cherry virus A isolate DG-FC9

Primer name Oligonucleotide sequence (5' to 3') Amplicon size
CVA-JR-F1 CTTCCACCAATTTCCAAACAC 1,242 bp
CVA-JR-R1 AGATTGAATGATCCAAGAGTCA
CVA-JR-F2 GAATCATCCTTGGCCAAGCT 1,245 bp
CVA-JR-R2 ACCCAAATGA ATTGGAGCAC T
CVA-JR-F3 GTCCCTGAAGTTGGACCTC 1,245 bp
CVA-JR-R3 CAATTGGAAT GGATTCAGTT TAT
CVA-JR-F4 AAGATTTCCAATTCATTCAAATGT 1,245 bp
CVA-JR-R4 GAGTATTCAT GATTTTCTGG CA
CVA-JR-F5 AGTATGATGTTAGAAAGACTCAT 1,153 bp
CVA-JR-R5 TGTAACACAT ATGATGATTG CC
CVA-JR-F6 ATGAAGTTGAGCTGGAGGCT 1,158 bp
CVA-JR-R6 CCATGCCTTCACATTTGTGG
Primer name Oligonucleotide sequence (5' to 3')
5' RACE CVA-5'-R2 AGAGGAGATGGTTTTCAACGA
CVA-5'-R1 AGGACCTCAAAGCGGTTATG
3' RACE CVA-3'-F1 CTTGACTGCCAGAGCAACTA
CVA-3'-F2 TTCATCACCGTCACCAATCAA


The complete genome sequence of the CVA isolate isolated from sweet cherry, designated as CVA-DG-FC9, was 7,434 nt in length (excluding the poly[A] tail), with a G + C content of 50.2% (Table 2). The 5'- and 3'-untranslated regions were 106 and 299 nt in length, respectively. NCBI ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) indicated that the genome contained two ORFs. ORF1 (nt 107–7135) encoded a polyprotein (Pol) with four conserved domains that were identified using the NCBI Conserved Domains Database as a methyltransferase (amino acid [aa] 44–351), an RNA helicase (aa 818–1096), an RNA-dependent RNA polymerase (aa 1279–1548), and a coat protein (aa 2178–2335). ORF2 (nt 5452–6843), which was located within a different reading frame, encoded a movement protein (MP). Pairwise comparison of CVA-DG-FC9 with 10 other complete CVA isolate genomes, using DNAMAN ver. 7.0 (Lynnon Biosoft), indicated that the whole CVA-DG-FC9 shared the highest nt sequence identity (99.26%) with the CVA isolate Niagara-B1 (GenBank accession no. MF062118). A comparison of homology with the CVA reference genome (NC_003689) revealed that the CVA-DF-FC9 isolate had 98.4% nt sequence identity. The similarities of the individual CVA-DG-FC9 ORF1 (Pol) and ORF2 (MP) sequences with other CVA ORF1 and ORF1 sequences ranged from 80.7% (India JK isolate, FN691959) to 99.2% (Canada Niagara-B1 isolate, MF062118) and from 90.7% (India JK2 isolate, LC 422952) to 99.4% (Canada Niagara-D22 isolate, MF062119) nt sequence identity, respectively. To the best of our knowledge, this is the first report of a complete genome sequence of CVA isolated from sweet cherry in Korea. CVA usually was confirmed as a co-infection with other viruses, and a high infection rate of 65% was reported in previous studies (Simkovich et al., 2021). It is necessary to investigate the virus outbreak affecting cherries grown in Korea, and to reveal the damage patterns caused by viruses including CVA.

Genomic features of CVA DG-FC9

Genome feature Total
Genome size (bp) 7,434
G + C content (%) 50.2
Polyprotein (aa) 2,342
Movement protein (aa) 463
Accession number (GenBank) LC437353


Nucleotide sequence accession number

The complete genome sequence of CVA isolate DG-FC9 has been deposited in GenBank (accession no. LC437353).

적 요

단양앵두는 장미과에 속하는 비전환성 식물이다. 본 연구의 목적은 국내 대구에서 재배되는 단양앵두에서 Cherry virus A (CVA)의 전체 유전체를 결정하는 것이다. CVA DG-FC9 분리주는 7,434 뉴클레오티드로 구성되어 있으며, 폴리단백질과 이동단백질을 암호화한다. DG-FC9 전체 유전체는 Niagara-B1 분리주와 가장 높은 뉴클레오티드 상동성(99.26%)을 보였다. 이는 국내 단양앵두에서 동정된 CVA 전체 유전체의 최초 보고이다.

Acknowledgments

This study was carried out with the support of ‘R&D Program for Forest Science Technology (Project No. 20214 00B10-2125-CA02)’ provided by Korea Forest Service (Korea Forestry Promotion Institute).

Conflict of Interest

The authors have no conflict of interest to report.

References
  1. James D and Jelkmann W. 1998. Detection of Cherry virus A in Canada and Germany. Acta Hortic. 472, 299-304.
    CrossRef
  2. Jelkmann W. 1995. Cherry virus A: cDNA cloning of dsRNA, nucleotide sequence analysis and serology reveal a new plant capillovirus in sweet cherry. J. Gen. Virol. 76, 2015-2024.
    Pubmed CrossRef
  3. Jo Y, Lian S, Cho JK, Chu H, Choi H, and Cho WK. 2017. First report of Asian prunus virus 2 and Cherry virus A infecting Japanese apricot (Prunus mume) in Korea. Plant Dis. 101, 1683.
    CrossRef
  4. Kinoti WM, Constable F, Nancarrow N, Rodoni B, and Plummer KM. 2016. First report of Cherry virus A (CVA) in Australia and the first report of CVA infecting Prunus cerasifera. Plant Dis. 100, 1511.
    CrossRef
  5. Koinuma H, Nijo T, Iwabuchi N, Yoshida T, Keima T, Okano Y, Maejima K, Yamaji Y, and Namba S. 2016. First complete genome sequence of Cherry virus A. Genome Announc. 4, e00498-16.
    Pubmed KoreaMed CrossRef
  6. Noorani MS, Awasthi P, Singh RM, Ram R, Sharma MP, Singh SR, Ahmed N, Hallan V, and Zaidi AA. 2010. Complete nucleotide sequence of Cherry virus A (CVA) infecting sweet cherry in India. Arch. Virol. 155, 2079-2082.
    Pubmed CrossRef
  7. Park CY, Baek DS, Oh J, Choi JY, Bae DH, Kim JS, Jang GH, and Lee SH. 2016. Survey of the incidence of viral infections in Calanthe spp. and characterization of a GW isolate of Cymbidium mosaic virus in Korea. Res. Plant Dis. 22, 65-71.
    CrossRef
  8. Simkovich A, Kohalmi S, and Wang A. 2021. First report of Cherry virus A infecting cherry in Ontario, Canada. New Dis. Rep. 44, e12022.
    CrossRef
  9. Svanella-Dumas L, Marais A, Gentit P, Lamorte J, and Candresse T. 2005. First report on the natural occurrence of Cherry virus A in Mirabelle plum (Prunus domestica var. insititia). Plant Dis. 89, 433.
    Pubmed CrossRef
  10. Tatineni S, Afunian MR, Gowda S, Hilf ME, Bar-Joseph M, and Dawson WO. 2009. Characterization of the 5'- and 3'-terminal subgenomic RNAs produced by a capillovirus: evidence for a CP subgenomic RNA. Virology 385, 521-528.
    Pubmed CrossRef
  11. Yoshikawa N, Sasaki E, Kato M, and Takahashi T. 1992. The nucleotide sequence of apple stem grooving capillovirus genome. Virology 191, 98-105.
    Pubmed CrossRef


March 2022, 58 (1)