search for




 

Searching for marker genes to identify the telomeric silencing regulators in Saccharomyces cerevisiae
Korean J. Microbiol. 2022;58(4):211-221
Published online December 31, 2022
© 2022 The Microbiological Society of Korea.

Junsoo Oh, Seho Kim, Donghyun Kim, and Jung-Shin Lee*

Department of Molecular Bioscience, College of Biomedical Science, Kangwon National University, Chuncheon 24341, Republic of Korea
Correspondence to: *E-mail: jungshinlee@kangwon.ac.kr; Tel.: +82-33-250-8540; Fax: +82-33-259-5641
These authors contributed equally to this work.
Received November 7, 2022; Revised November 25, 2022; Accepted November 25, 2022.
Abstract
Telomeres in most eukaryotes are composed of heterochromatin structure. Genes adjacent to the telomeres undergo the telomere position effect (TPE) due to the spreading of telomeric heterochromatin. Saccharomyces cerevisiae is a good model organism for the study of heterochromatin and TPE. In particular, a yeast strain at which a uracil biosynthetic gene (URA3) is inserted in the subtelomere of ChrVII-L has been widely used as for a screening tool for TPE regulators. However, there is much inconvenience because a lot of time and labor are required for construction of yeast strains and further validation of reporter assay results. In this study, we introduce at least six marker genes definitely undergoing transcriptional silencing by TPE. We expect that qRT-PCR analyses targeting our subtelomere marker genes will clarify whether some potential TPE regulators are really modulating the subtelomeric gene silencing.
Keywords : Saccharomyces cerevisiae, marker gene, telomere position effect, telomeric silencing
Body

진핵생물들에서 centromere, telomere등으로 대표되는 heterochromatin 구조는 recombination이 되지 않도록 특별한 수준의 보호가 필요한 DNA 서열들에 주로 형성되어 있다(Grewal and Jia, 2007; Kueng et al., 2013). Heterochromatin 구조들은 고도로 응축된 구조이기 때문에 그 근처에 유전자들이 있다면 transcription factor등의 접근이 제한되고 발현이 거의 되지 않는 position effect를 받게 된다(Grewal and Jia, 2007; Kueng et al., 2013). Position effect variegation (PEV)는 특히 Drosophila에서 가장 많이 연구되어 왔으며 후성유전학(epigenetics) 연구의 중요한 model 중 하나로 사용되었다(Grewal and Jia, 2007; Kueng et al., 2013). 실제로 후에 H3K9 methyltransferase로 알려지게 될 SuVar(3-9)를 비롯한 150여 개의 chromatin 조절 단백질들이 Drosophila에서 PEV의 suppressor 혹은 enhancer를 찾는 screening을 통해 밝혀졌다(Reuter and Wolff, 1981; Schotta et al., 2002).

Saccharomyces cerevisiae는 heterochromatin 연구의 좋은 모델 생물체이며 telomere는 대표적인 heterochromatin 지역이다(Kueng et al., 2013). Saccharomyces cerevisiae의 telomere position effect (TPE)는 Sir complex (Sir2, Sir3, Sir4)에 의해 형성되는 telomeric heterochromatin에 의해 나타난다(Kueng et al., 2013; Bi, 2014; Oh et al., 2022). Telomere 근처의 여러 nucleation site들에서 Sir complex의 조립이 시작되고, Sir complex는 telomere에서 먼 쪽 방향으로 퍼져나간다(Hoppe et al., 2002; Rudner et al., 2005; Johnson et al., 2009). Telomere로부터의 거리가 멀어질수록 Sir complex의 spreading 강도가 약해지며, telomere 근처에 있는 유전자들(subtelomeric gene)은 TPE를 받아서 gene silencing을 겪는다(Gottschling et al., 1990; Kueng et al., 2013; Bi, 2014; Oh et al., 2022).

Saccharomyces cerevisiae에서 간단한 growth assay를 통해 TPE의 조절자들을 찾는 방법이 고안되었다(Gottschling et al., 1990). 5-FOA는 uracil 생합성에 중요한 URA3 유전자의 산물에 의해 독성물질로 전환되기 때문에 URA3의 발현이 억제된 균주만 5-FOA (Fluoroorotic acid) 배지에서 살 수 있다(Boeke et al., 1987). ChrVII-L의 telomere에 위치한 ADH4 유전자 promoter 뒤에 URA3 ORF를 삽입시킨 yeast 균주는 TPE에 의해 URA3의 대사산물이 충분히 발현되지 못해서 5-FOA 배지에서 살 수 있다(Gottschling et al., 1990). 하지만 telomeric silencing의 조절자들의 돌연변이 주에서는 URA3의 발현이 억제되지 못하기 때문에 이 배지에서 살 수 없다(Gottschling et al., 1990). 이 방법을 이용해서 N-terminal acetyltransferase A (NatA)의 Ard1, H3K79 methylase Dot1, H3K4 methylase Set1, H2BK123 ubiquitinase Rad6 등 다양한 telomeric silencing 조절단백질들을 발견할 수 있었다(Aparicio et al., 1991; Huang et al., 1997; Nislow et al., 1997; Singer et al., 1998; Miller et al., 2001; Krogan et al., 2002).

하지만 이 growth assay를 통해 telomeric silencing의 조절자를 찾는 방법에는 번거로움과 한계가 있다. 첫번째로는, ChrVII-L-URA3 reporter가 있는 wildtype 균주에서 telomere silencing의 조절자로 의심되는 유전자들을 knockout 시킨 균주를 새롭게 제작해야하는 번거로움이 있다(Gottschling et al., 1990). 또한, URA3는 본래 locus가 아니라 인위적으로 ChrVII-L에 삽입 되었기 때문에 telomeric silencing의 조절자로 의심되는 유전자가 자연적인 telomere locus의 silencing을 조절 하는지 추가적인 실험이 필요하다(Gottschling et al., 1990). 마지막으로, URA3 유전자가 기본적으로 대사과정에 관여하는 유전자이기 때문에 대사과정에 관여하는 유전자들의 돌연변이 균주들은 실제로 telomeric silencing에 관여하지 않음에도 FOA 배지에서의 성장에 변화를 주기도 한다(Rossmann et al., 2011; Takahashi et al., 2011).

따라서, 더 빠르고 쉽게 Sir complex에 의한 subtelomeric gene silencing의 조절단백질을 찾게 해줄 방법이 필요하다. Yeast에는 single gene deletion strain들의 library가 널리 보급되어 있고, 이 돌연변이 주들의 mRNA를 추출하여 subtelomere 표적 유전자들의 gene silencing에 결함이 생기는지 qRT-PCR로 확인하는 방법은 아주 간단하다(Giaever and Nislow, 2014). 다만, subtelomere에 있는 상당 수의 유전자들이 Sir complex에 의해 gene silencing이 되지 않거나, 되더라도 유의미한 변화를 관측하기는 어렵기 때문에 Sir complex에 의해 확실히 silencing이 되고 있는 표적유전자를 제시하는 것이 중요하다(Ellahi et al., 2015; Yeom et al., 2022).

Saccharomyces cerevisiae에서 subtelomere 유전자들 중 Sir complex에 의해 확실히 silencing되는 표적유전자들을 제시하기 위해 Sir complex의 핵심단백질인 Sir2를 deletion시킨 균주 (Δsir2)에서 RNA sequencing한 결과를 분석했고 19개의 표적 유전자 후보군을 선별했다(Yeom et al., 2022). 이들 중 확실한 표적 유전자들을 제시하기 위해, qRT-PCR을 했을 때 Δsir2에서 가장 유의미하게 발현이 증가한 6개의 subtelomere 유전자들(YBL113C, YIL177C, YEL077C, COS12, YLL066C, YRF1-6)을 찾았다. 이 6개의 유전자들은 Sir complex를 구성하는 다른 두 단백질들인 Sir3, Sir4가 각각 결실된 돌연변이 주에서도 확실하게 발현이 증가했고, Sir complex가 telomere에 올 수 있도록 도와주는 두 단백질인 yKu70, yKu80가 각각 결실된 균주에서도 확실히 발현이 증가하였다(Moretti et al., 1994; Mishra and Shore, 1999; Moretti and Shore, 2001; Kueng et al., 2013). 만일 어떤 유전자의 돌연변이 주에서 이 6개의 marker 유전자들의 발현이 증가했다면 그 유전자는 S. cerevisiae에서 telomere position effect와 gene silencing의 잠재적인 조절자로 정의할 수 있다. 이런 점에서 여러 염색체의 subtelomeric region에 흩어져 있는 이 유전자들을 TPE 조절자를 찾기 위한 새로운 마커 유전자로 제안할 수 있다.

재료 및 방법

Saccharomyces cerevisiae 균주

이 연구에 사용된 균주들은 Table 3에 정리되어 있다.

Yeast strains used in this study
Strains Genotype Source
FM391 FM391 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 BY4741
Δsir2 JL400 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 sir2::KanMX Yeast KO library
Δsir3 JL1188 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 sir3::KanMX Yeast KO library
Δsir4 JL1189 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 sir4::KanMX Yeast KO library
Δyku70 JL1205 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 yku70::KanMX Yeast KO library
Δyku80 JL1206 MATa his3∆0 leu2∆0 met15∆0 ura3∆0 yku80::KanMX Yeast KO library


RNA sequencing 데이터 분석

Gene Expression Omnibus (GEO) database에 GSE190545로 게시된 Yeast wild-type 균주(FM391)와 Δsir2 균주의 RNA sequencing data를 이용하여 분석했다(Yeom et al., 2022). Yeom et al.(2022)의 연구와 동일한 방식으로 raw data를 processing 하였는데, 간단히 설명하자면 QC (FastQC) – Trimming (Trimmomatic) – QC (FastQC) – Alignments of reads to reference genome (Tophat2)을 순서대로 수행했다(Kim et al., 2013; Bolger et al., 2014). 이후 Samtools를 이용하여 bam file들을 bed format으로 변환했고, TDF command를 통해 sorting된 data들을 TDF format의 file로 변환하였다. TDF file은 IGV (Integrative genomics viewer)를 통해 시각화하였다(Robinson et al., 2011). DESEQ2 software를 통해 Δsir2 균주에서 유의미하게 발현이 변화된 유전자들(DEGs; Differentially expressed genes)들을 선별했다(Love et al., 2014).

RNA preparation from S. cerevisiae cells and cDNA synthesis

OD600 = 1.0, 10 ml의 yeast cell들을 가지고 MN (Macherey-nagel) Nucleospin® RNA II kit (740955.5)의 설명서에 따라 RNA를 추출하였다. Thermo Scientific™ NanoDrop™ 2000/2000c Spectrophotometers으로 RNA를 정량한 후, 500 ng의 RNA를 TOPscript™ cDNA Synthesis Kit (Enzynomics EZ005S)의 설명서에 따라 oligodT primer를 이용해서 cDNA로 합성했다.

Quantative RT PCR (qRT-PCR)과 통계 분석

1/100로 희석한 cDNA 2.5 μl + 1 μM농도의 Forward와 Reverse primer 각각 2.5 μl씩 + 7.5 μl의 Enzynomics Topreal qPCR 2X premix (SYBR green with low ROX) (Cat. RT500M)을 합쳐서 15 μl의 Rxn mixture를 만든 후 Applied Biosystems 7500 Real-Time PCR Instrument를 이용하여 qPCR premix의 권장 설명서에 따라 qRT-PCR 실험을 수행하였다. 4번의 독립적인 qRT-PCR실험 후 ACT1유전자의 발현양으로 normalization이 끝난 값들의 평균과 표준편차를 구하여 막대 그래프를 그렸다. 통계 분석을 위해 F-검정을 통해 등분산/이분산을 판별했고, 등분산 또는 이분산 가정 두 집단 간의 T-검정을 통해 나온 p-value에 따라 샘플 간의 변화가 유의미한지 판별하였다.

PCR

Thermo fisher사의 Dream Taq polymerase의 권장 설명서에 따라 10 μl의 rxn mixture를 만들었고, 이 때 1/100로 희석한 cDNA 1 μl를 template로 사용하였다. Dream Taq polymerase의 권장 설명서에 따라 PCR cycle을 정했으며, ACT1의 경우 27 cycles, 나머지 subtelomere marker gene들은 30 cycles로 설정하였다.

결 과

이전의 연구를 통해 S. cerevisiae의 32개 telomere ends에서 20 kb 이내에 위치하고 있는 242개의 유전자(Subtelomeric genes = 242)들을 확인했고, Δsir2균주의 mRNA sequencing data 분석을 통해 Δsir2에서 발현이 유의미하게 변화한 유전자들을 선별하였다(Yeom et al., 2022). 그 결과, Sir2에 의해 발현이 억제되고 있었던 44개의 유전자들(Increased genes at Δsir2 strain, n = 44, p-value < 0.05)과 발현이 증가했던 4개의 유전자들(Decreased genes at Δsir2 strain, n = 4, p-value < 0.05)을 보고하였다(Yeom et al., 2022) (Table 1). 즉, subtelomere의 유전자들의 다수(198/242; 약 82%)가 Sir2-dependent한 gene silencing을 겪지 않거나, 보편적인 방법으로 silencing이 되고 있다는 것을 확인하기 어렵다는 것이다.

Distribution of subtelomere genes (n = 242) in each telomere of <italic>Saccharomyces cerevisiae</italic> and change in expression in <italic>Δsir2</italic>
Chromosome Arm Subtelomeric genes (n = 242), genes are arranged according to the proximity to each telomere end
I L PAU8 YAL067W-A SEO1 YAL065C YAL064W-B TDA8
R PHO11 YAR068W YAR066W YAR064W
II L YBL113C YBL112C YBL111C PAU9 MIX23 SRO77 PKC1 SEA4
R COS2 PAU24 MAL32 YBR298C-A MAL31 MAL33 YBR296C-A PHO89 PCA1
III L GEX1 VBA3 YCL068C HMLALPHA2 HMLALPHA1 CHA1 VAC17 MRC1
R YCR108C AAD3 RDS1 ADH7 PAU3 YCR102C YCR101C YCR099C GIT1
IV L COS7 MPH2 SOR2 HXT15 THI13 AAD4 YDL242W
R YRF1-1 PAU10 YDR541C IRC4 FDC1
V L YEL077C YEL076C-A YEL075C YEL073C RMD6 DLD3 DSF1
R YRF1-2 YER190C-B YER189W YER188W YER188C-A YER187W YER186C PUG1 TOG1
VI L YFL068W YFL067W YFL066C YFL065C YFL064C COS4 DDI2 SNO3 SNZ3 THI5 AGP3
R YFR057W IRC7 YFR054C HXK1 RPN12 RET2
VII L COS12 YGL262W PAU11 YGL260W YPS5 YGL258W-A VEL1 MNT2 ADH4
R YRF1-3 COS6 PAU12 MAL12 MAL11 MAL13
VIII L YHL050C YHL049C COS8 YHL048C-A ARN2 PAU13 YHL044W ECM34 YHL042W YHL041W ARN1
R YHR219W YHR218W IMD2 PHO12 YHR214C-E YHR214C-D YHR214C-C YHR214C-B
IX L YIL177C PAU14 VTH1 IMA3
R YIR042C PAU15 YPS6 GTT1 HYR1 IRC24 YIR035C LYS1
X L YJL225C PAU1 VTH2 IMA4 HXT9
R COS5 MPH3 SOR1 HXT16 THI11 AAD10 YJR154W
XI L PAU16 YKL222C MCH2 FRE2 COS9 SRY1
R GEX2 VBA5 NFT1 FLO10
XII L YLL067C YLL066W-B YLL066C PAU18 AYT1 MHT1 MMP1
R YRF1-5 YRF1-4 YLR464W YLR462W PAU4 YLR460C GAB1
XIII L YML133C COS3 YML131W ERO1 COX14 MSC1 RSC9 ERG13
R PAU19 ERR3 SNO4 YMR321C YMR320W FET4 ADH6 YMR317W DIA1 YMR315W-A
XIV L YRF1-6 COS1 DDI3 SNO2 SNZ2 THI12 AAD14 RPD3 PEX6
R YNR077C PAU6 COS10 YNR075C-A AIF1 MAN2 HXT17 YNR071C PDR18
XV L YOL166W-A AAD15 YOL164W-A BDS1 YOL163W YOL162W PAU20 YOL160W YOL159C-A CSS3 ENB1
R YRF1-8 PAU21 YOR394C-A ERR1 HSP33 FEX1 YOR389W FDH1
XVI L YRF1-7 PAU22 ERR2 HSP32 FEX2 YPL278C YPL277C
R YPR204W YPR203W YPR202W ARR3 ARR2 ARR1 SGE1 YPR196W YPR195C

: increased genes at Δsir2 strain (n = 44, p < 0.05)

: decreased genes at Δsir2 strain (n = 4, p < 0.05)

The list shows the subtelomeric genes (n = 242) located within 20 kb from ends of 32 telomeres of 16 chromosomes in S. cerevisiae as a previous study (Yeom et al., 2022). After reanalyzing mRNA sequencing results of wildtype and Δsir2 strain reported in a previous study (Accession number GSE190545 from Gene Expression Omnibus database; [Yeom et al., 2022]), we confirmed and listed the increased genes (highlighted as red colors; n = 44, p < 0.05) and decreased genes (highlighted as blue colors; n = 4, p < 0.05) at Δsir2 strain.



Sir2에 의해 가장 확실하게 silencing되는 유전자들을 찾기 위해 Sir2에 의해 발현이 억제되고 있었던 44개의 유전자들(Increased genes at Δsir2 strain, n = 44, p-value < 0.05) 중 (1) 가능한 다른 telomere에 위치해 있고, (2) Δsir2에서 발현 증가율(log2Foldchange)이 크며, (3) Δsir2에서의 발현량(Reads per million; RPM)이 높고, (4) RT-PCR 또는 qRT-PCR에 의해 만들어질 amplicon에 비해 긴 300 bp 이상의 19개 유전자들을 선별했다(Fig. 1 and Table 2). RNA sequencing 결과가 유효한지 확인하기 위해 Δsir2에서 추출한 RNA를 cDNA로 합성한 후 19개의 표적 유전자들에 결합하는 primer set으로 qRT-PCR하였다(Figs. 1의 IGV track 내의 빨간 박스, 2A and Table 4). 반복적인 실험들에서도 Sir2에 의해 silencing이 될 것으로 생각되는 확실한 표적들을 제시하기 위해, p-value에 따라 가장 유의미한 6개의 유전자들(YBL113C, YIL177C, YEL077C, COS12, YLL066C, YRF1-6)을 선별했다(Figs. 1, 2A and 2B). qRT-PCR 결과의 유효함을 한 번 더 확인하기 위해, cDNA를 가지고 RT-PCR을 한 후, agarose gel에 확인했다(Fig. 2C). 적어도 이 6개의 표적 유전자들이 Δsir2에서 발현이 확실히 증가한다는 것을 한 번 더 확인할 수 있었다(Fig. 2C).

Information about 19 candidates of subtelomere marker genes
Telomere Product Length Log2 FoldChange Adjusted p-value Normalized values of mapped reads
WT1 WT2 Δsir2-1 Δsir2-2
TELII-L YBL113C 2379 1.220287 0.013331 625.06 632.5435 1065.964 1859.707
TELIII-R AAD3 1092 1.239363 0.005548 220.1848 254.1793 489.2608 627.9674
TELIII-L VBA3 1377 3.277489 6.27E-09 11.43036 22.51303 154.0651 171.5638
TELIX-L YIL177C 5665 1.358174 0.001483 1523.245 1473.514 2964.712 4713.605
TELV-L YEL077C 3834 1.356004 0.009462 234.6231 207.7008 405.9824 722.5475
TELVI-R YFR057W 456 7.836721 4.26E-10 0.601598 0.726227 145.7373 155.0673
TELVII-L COS12 1143 2.705257 1.97E-09 77.6061 85.69475 691.211 377.2204
TELVIII-L ARN2 1863 2.166007 8.46E-12 434.3535 429.2 1898.748 1976.283
TELVIII-R YHR219W 1875 1.990529 0.014746 16.24314 21.7868 52.04902 96.77957
TELX-L YJL225C 5665 2.232986 0.000957 45.72142 63.18172 126.9996 380.5197
TELX-L IMA4 1770 1.576794 0.003574 62.56616 56.64568 154.0651 200.1577
TELXII-L YLL066C 3717 2.024473 0.003145 34.89267 42.84738 91.60628 221.0533
TELXIII-R ERR3 1314 4.994489 2.90E-07 1.804793 2.904907 41.63922 104.4779
TELXIV-R COS10 1125 1.342867 0.038346 232.8183 244.7384 345.6055 861.1182
TELXIV-L YRF1-6 5728 1.454701 0.006881 87.83326 105.3029 206.1141 320.0324
TELXV-L AAD15 432 3.298207 3.47E-07 7.82077 14.52453 95.7702 120.9745
TELXV-L YOL163W 510 1.93748 0.026982 12.63355 18.88189 49.96706 69.28537
TELXVI-L YRF1-7 5728 1.665458 0.002313 83.02048 96.58815 201.9502 364.0232
TELXVI-R YPR204W 3099 1.698954 0.017627 52.9406 55.19323 97.85216 249.6473


Primers used in this study
Primer name Sequence
F-ACT1-1120-RT CTGCCGGTATTGACCAAACT
R-ACT1-1264-RT CGGTGATTTCCTTTTGCATT
YBL113C-F-RT CGCTCGAGAAAGTTGGAGTT
YBL113C-R-RT CTGTCGATGATGCCTGCTAAA
AAD3-F-RT CCAAGGTAAATGGAACGTGTTG
AAD3-R-RT AAATCTTCCACCTCCCATGAC
VBA3-F-RT AGCGACTCCATTAAGAACGTATT
VBA3-R-RT TATCTTCTGGTGTCTCGTCCT
YIL177C-F-RT GACAGTTGAGGAGCAGATATGAA
YIL177C-R-RT CCTATCAGCATCGAGAGGAATG
YEL077C-F-RT CTAGGAATGCACTTGCGAGAT
YEL077C-R-RT GTAGAACAGCCCTATCAGCATC
YFR057W-F-RT CCTTTCTTTGCGTGGCAATATAC
YFR057W-R-RT CTGAGACGAAGTCGTTGCTAAA
COS12-F-RT GCTTACTTAAACGGTCTCCTTACT
COS12-R-RT ACCTGAATTTGTCGATCCCTATT
ARN2-F-RT AGCATATGGCTCACCACTAAC
ARN2-R-RT GAAGGAACATAGGCGCTGAA
YHR219W-F-RT TGGTAGCGGTTCACAAAGAG
YHR219W-R-RT CCAACTTCTCTGCTCGAATCT
YJL225C-F-RT CGGTTCACAAAGAGCTGGATAG
YJL225C-R-RT TCTCTGCTCGAATCCCTACATAA
IMA4-F-RT GGAAGGAGGCCTTGAGATTTAG
IMA4-R-RT TGTGAAGCTGAACAGTTTCTTATTG
YLL066C-F-RT TGGTAGCGGTTCACAAAGAG
YLL066C-R-RT CCAACTTCTCTGCTCGAATCT
ERR3-F-RT GTCCAGCTCAGTTAGCAGAATA
ERR3-R-RT CCACGAGGACCAATCATCTT
COS10-F-RT GCCAGTAGTTCAAATACAGTACA
COS10-R-RT CGTCCCAATCAGCAGAGTAT
YRF1-6-F-RT TGGTAGCGGTTCACAAAGAG
YRF1-6-R-RT CCAACTTCTCTGCTCGAATCT
AAD15-F-RT CCGAACAAACAGATGCAGAAAT
AAD15-R-RT CCTTAGAGCGAACATAGGCAATA
YOL163W-F-RT GAAAGGATGGTTCACTGAGAGG
YOL163W-R-RT AGTGACATACCTTGCCTATTGTT
YRF1-7-F-RT TGGTAGCGGTTCACAAAGAG
YRF1-7-R-RT CCAACTTCTCTGCTCGAATCT
YPR204W-F-RT TGGTAGCGGTTCACAAAGAG
YPR204W-R-RT CCAACTTCTCTGCTCGAATCT


Fig. 1. Expression levels of 19 candidates of subtelomere marker genes in Δsir2 strain and their loci within S. cerevisiae genome. Thirty two subtelomere regions (within 20 kb from each telomere end) from 16 chromosomes in S. cerevisiae genome are depicted in the schematic diagram. Subtelomere genes and selected 19 candidates of marker genes are highlighted as gray and black boxes, respectively. IGV tracks show the mapped reads of RNA sequencing from Wild-type (orange color) and Δsir2 (blue color) strains. Amplicon of qPCR primer set is highlighted as red box in each IGV track.

Fig. 2. Six marker genes are selected from 19 candidates of marker genes for subtelomere gene silencing. (A) qRT-PCR results show the expression of each of 19 candidate genes in Wild-type and Δsir2 strain. Expression level of each gene was normalized with that of ACT1. Bar graph shows the average and standard deviation of four independent experiments. To verify the significance of differential expression, student’s t-test was performed and (B) six marker genes with highest significance were selected as the marker genes (ns: not significant; *p < 0.05; **p < 0.01; ***p < 0.001). (C) RT-PCR of cDNA templates and agarose gel electrophoresis were performed for further validation of the qRT-PCR results. This Figure shows the representative data of four independent RT-PCR experiments.

Sir2는 Sir3, Sir4와 함께 Sir complex를 이루고, telomere heterochromatin은 이 Sir complex의 spreading에 의해 형성된다(Kueng et al., 2013). 따라서, 이 표적 유전자들이 Sir complex에 의해 silencing이 되는 유전자들이라면 Sir3 혹은 Sir4가 결실된 돌연변이 주에서도 발현이 확실히 증가해야 한다. 6개의 표적 유전자 중 COS12는 기존에 URA3 reporter 유전자가 삽입되어 있는 ChrVII-L에 위치한 유전자이면서, 이 reporter assay를 통해 telomeric silencing 조절단백질로 제시된 ARD1, DOT1, SWI4의 결실 돌연변이 주에서 일관되게 silencing의 결함이 생기는 유전자이다(Takahashi et al., 2011). 반면, ERR3는 subtelomere에 있지만 Sir2가 결실된 상황에서 적어도 유의미하게 발현이 증가하지는 않는 것으로 보이는 유전자이다(Fig. 1, 2A and 2B). COS12ERR3, 이 두 유전자들을 Sir complex에 의한 silencing의 positive와 negative control로 설정한 후, 5개의 표적 유전자들(YBL133C, YIL177C, YEL077C, YLL066C, YRF1-6)이 정말 Sir complex에 의해 확실히 silencing되는 유전자들인지 확인하는 실험을 진행했다. Δsir3, Δsir4 균주의 qRT-PCR을 했을 때 5개의 표적 유전자들과 COS12의 발현이 모두 확실히 증가하는 것을 확인했다(Fig. 3A). 반면, SIR2가 결실 되었을 때 발현이 변화가 없거나 오히려 감소했던 ERR3SIR4가 없을 때 유의미한 발현 변화가 관찰되지 않았다(Fig. 3A).

Fig. 3. Six marker genes are definitely silenced by Sir complex. qRT-PCR results show the expression of marker genes, YBL113C, YIL177C, YEL077C, YLL066C, and YRF1-6 in (A) Δsir3 and Δsir4 strains or (B) Δyku70 and Δyku80 strains. COS12 was not only selected as the marker gene, but also as the positive control due to its localization in TEL07L, the telomere for conventional reporter assay. ERR3 had been among the 19 marker candidates, but was used as the negative control since expression was not significantly changed at validation experiments.

Telomere는 TG1-3 telomere repeat으로 이루어져 있고, 이 cis-element들에 Rap1이 먼저 결합하고, Sir complex의 component 중 Sir4가 Rap1에 의해 telomere에 결합하게 된다(Kyrion et al., 1993; Moretti et al., 1994; Moretti and Shore, 2001; Luo et al., 2002; Kueng et al., 2013). 이 때, Rif1/2가 Rap1의 C-terminal domain을 두고 Sir4와 경쟁하는데, chromosome ends에 결합하는 heterodimer인 yKu70/80 complex가 이 경쟁관계에서 Rap1과 Sir4의 결합을 도와준다(Kyrion et al., 1993; Mishra and Shore, 1999). 결국, yKu70, yKu80, Rap1등은 Sir complex (Sir2,3,4)가 telomere에 결합하는 것을 도와주며, Sir complex에 의한 telomere heterochromatin 형성을 도와준다(Moretti et al., 1994; Mishra and Shore, 1999; Moretti and Shore, 2001; Kueng et al., 2013). Rap1은 essential gene이라서 결실 돌연변이 균주의 제작이 불가능하기 때문에(Shore and Nasmyth, 1987), Rap1을 제외한 yKu70 혹은 yKu80가 결실된 돌연변이 주에서 6개의 표적 유전자들이 Sir complex에 의해 silencing 되는지 확인하기 위해 qRT-PCR을 했다(Fig. 3B). 5개의 표적 유전자들과 COS12는 yKu70 혹은 yKu80의 돌연변이 균주에서 발현이 확실히 증가했지만, ERR3의 경우 발현이 증가하지 않았다. 결론적으로, 우리는 이 연구를 통해 subtelomere에 있는 많은 유전자들 중 Sir complex에 의해 확실히 gene silencing을 겪는 6개의 유전자들(YBL133C, YIL177C, YEL077C, YLL066C, YRF1-6)을 제시한다. Subtelomere gene들(n = 242)중 일부가 확실하게 Sir complex에 의해 silencing이 되기 때문에, 이 6개의 표적 유전자들은 S. cerevisiae에서 Sir complex 의존적인 gene silencing의 조절단백질을 선별하는데 중요한 역할을 할 것으로 기대된다.

고 찰

이전 많은 연구에서는 telomeric silencing의 조절유전자들을 screening하기 위하여 해당 균주에 reporter 유전자(URA3)를 telomere에 삽입한 균주를 제작했고, 해당 균주가 FOA 배지에서 생존하는지 확인하여 telomeric silencing 여부를 판단하였다(Gottschling et al., 1990; Aparicio et al., 1991; Huang et al., 1997; Nislow et al., 1997; Singer et al., 1998). 이 방법은 high-throughput sequencing 및 annotation이 발전하기 이전에 많은 subtelomeric silencing의 조절자를 찾게 해주었다. 하지만 균주를 제작하는 데 번거롭고, telomere에 삽입된 유전자들은 자연적으로 그 locus에 있는 게 아니기 때문에 자연적인 telomere가 이 telomeric silencing 조절자의 후보에 의해 silencing이 되는 지 확인하는 추가적인 노력이 필요하다. 또한, 5-FOA에서 균주가 죽는 것을 확인해도 그 원인이 silencing의 결함에 의해 생긴 것인지, 아니면 이 유전자가 nucleotide, amino acid등의 대사경로를 조절하여 생긴 일인지 판단하기 어렵다(Rossmann et al., 2011; Takahashi et al., 2011).

이러한 문제점들을 극복하기 위해 우리는 S. cerevisiae genome database를 이용하여 32개에 해당하는 모든 telomere들에서 242개의 annotation된 subtelomere gene들을 선별하였고, Sir complex 단백질(Sir2, Sir3, Sir4)의 결실돌연변이 주들의 RNA sequencing을 했을 때 놀랍게도 Sir complex에 의한 silencing이 일부 유전자에만 나타난다는 것을 확인하였다(44/242; 약 18%) (Yeom et al., 2022) (Table 1). 심지어 표적 유전자로 선정된 19개의 유전자들 중 ERR3 등이 Sir complex에 의해 silencing 되지 않고 있는 것으로 보아, 확실히 Sir complex에 의해 silencing 되는 유전자들이 상당히 제한적이라는 것을 알 수 있었다(Figs. 2, 3). 따라서 TPE의 조절단백질 후보군들이 정말로 TPE를 조절하는 지 알기 위해서는 이 일부의 subtelomere 유전자들 중 확실히 Sir complex와 TPE에 의해 gene silencing을 겪는 유전자들을 제시해야한다.

또한 우리는 telomere들 간의 이질성(heterogeneity)을 고려하여 가능하면 다른 telomere에 분포하는 marker 후보유전자들을 선별했다(Fig. 1 and Table 1). 실제 S. cerevisiae의 telomere들을 현미경으로 보면 32개의 telomere가 몇개의 foci로 clustering이 되어있는 것이 관찰된다(Gotta et al., 1996; Taddei et al., 2004). 또한, telomere간에도 TPE에 의한 일관된 조절을 받는 게 아니라 각 telomere마다 Sir complex의 spreading에 의해 형성되는 heterochromatin domain의 너비가 다르기 때문에 어떤 임의의 TPE 조절 단백질이 특정 telomere만 조절할 가능성도 있을 것으로 보이고, 이를 감안하기 위해 가능하면 많은 telomere들을 볼 수 있는 marker 유전자들을 선별했다(Yeom et al., 2022). 결론적으로, 이 marker 유전자들을 활용하여 우리는 더 빠르고 쉽게 Sir complex에 의한 TPE와 telomeric silencing의 조절단백질을 찾을 수 있을 것으로 기대한다.

적 요

많은 진핵생물의 telomere는 heterochromatin 구조로 이루어져 있고 telomere 근처의 유전자들은 telomeric heterochromatin의 퍼짐(spreading)에 의해 발현이 억제되는 telomere position effect (TPE)를 겪는다. Saccharomyces cerevisiae는 이질염색질과 TPE 연구에 좋은 모델 생물체로 사용되었다. 특히, ChrVII-L의 telomere에 uracil 생합성 유전자(URA3)를 삽입한 균주를 통해 TPE 조절단백질들을 screening하는 방법이 널리 사용되어왔다. 하지만, 균주를 새로 제작해야 하고, 이 reporter assay의 결과가 유효한지 추가적으로 확인해야하는 등의 번거로움이 있다. 이 연구를 통해 우리는 TPE의 영향으로 확실히 silencing 상태로 다양한 염색체의 subtelomere 부분에 존재하는 6개의 마커 유전자들을 소개한다. 기존에 사용되었던 ChrVII-L의 subtelomeric region에 삽입된 URA3 마커와 비교했을 때, 이 6개의 마커 유전자들은 여러 염색체의 subtelomeric region에 존재하기 때문에, 실시간 PCR를 통해서 잠재적인 TPE의 조절단백질이 subtelomere gene silencing을 조절하는지를 명확하게 해줄 것이다.

감사의 말

이 논문은 한국연구재단의 지원(NRF-2020R1I1A3072234, 2020R1A6A3A13077356, NRF-2022R1A6A3A01087657)을 받아 수행되었다.

Conflict of Interest

Jung-Shin Lee is Editor of KJM. She was not involved in the review process of this article. Also, Authors have no conflicts of interest to report.

References
  1. Aparicio OM, Billington BL, and Gottschling DE. 1991. Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae. Cell 66, 1279-1287.
    Pubmed CrossRef
  2. Bi X. 2014. Heterochromatin structure: lessons from the budding yeast. IUBMB Life 66, 657-666.
    Pubmed CrossRef
  3. Boeke JD, Trueheart J, Natsoulis G, and Fink GR. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154, 164-175.
    Pubmed CrossRef
  4. Bolger AM, Lohse M, and Usadel B. 2014. Trimmomatic: a flexible trimmer for illumina sequence data. Bioinformatics 30, 2114-2120.
    Pubmed KoreaMed CrossRef
  5. Ellahi A, Thurtle DM, and Rine J. 2015. The chromatin and transcriptional landscape of native Saccharomyces cerevisiae telomeres and subtelomeric domains. Genetics 200, 505-521.
    Pubmed KoreaMed CrossRef
  6. Giaever G and Nislow C. 2014. The yeast deletion collection: a decade of functional genomics. Genetics 197, 451-465.
    Pubmed KoreaMed CrossRef
  7. Gotta M, Laroche T, Formenton A, Maillet L, Scherthan H, and Gasser SM. 1996. The clustering of telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces cerevisiae. J. Cell Biol. 134, 1349-1363.
    Pubmed KoreaMed CrossRef
  8. Gottschling DE, Aparicio OM, Billington BL, and Zakian VA. 1990. Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell. 63, 751-762.
    Pubmed CrossRef
  9. Grewal SI and Jia S. 2007. Heterochromatin revisited. Nat. Rev. Genet. 8, 35-46.
    Pubmed CrossRef
  10. Hoppe GJ, Tanny JC, Rudner AD, Gerber SA, Danaie S, Gygi SP, and Moazed D. 2002. Steps in assembly of silent chromatin in yeast: Sir3-independent binding of a Sir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation. Mol. Cell. Biol. 22, 4167-4180.
    Pubmed KoreaMed CrossRef
  11. Huang H, Kahana A, Gottschling DE, Prakash L, and Liebman SW. 1997. The ubiquitin-conjugating enzyme Rad6 (Ubc2) is required for silencing in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 6693-6699.
    Pubmed KoreaMed CrossRef
  12. Johnson A, Li G, Sikorski TW, Buratowski S, Woodcock CL, and Moazed D. 2009. Reconstitution of heterochromatin-dependent transcriptional gene silencing. Mol. Cell 35, 769-781.
    Pubmed KoreaMed CrossRef
  13. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, and Salzberg SL. 2013. Tophat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36.
    Pubmed KoreaMed CrossRef
  14. Krogan NJ, Dover J, Khorrami S, Greenblatt JF, Schneider J, Johnston M, and Shilatifard A. 2002. COMPASS, a histone H3 (Lysine 4) methyltransferase required for telomeric silencing of gene expression. J. Biol. Chem. 277, 10753-10755.
    Pubmed CrossRef
  15. Kueng S, Oppikofer M, and Gasser SM. 2013. SIR proteins and the assembly of silent chromatin in budding yeast. Annu. Rev. Genet. 47, 275-306.
    Pubmed CrossRef
  16. Kyrion G, Liu K, Liu C, and Lustig AJ. 1993. RAP1 and telomere structure regulate telomere position effects in Saccharomyces cerevisiae. Genes Dev. 7, 1146-1159.
    Pubmed CrossRef
  17. Love MI, Huber W, and Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550.
    Pubmed KoreaMed CrossRef
  18. Luo K, Vega-Palas MA, and Grunstein M. 2002. Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast. Genes Dev. 16, 1528-1539.
    Pubmed KoreaMed CrossRef
  19. Miller T, Krogan NJ, Dover J, Erdjument-Bromage H, Tempst P, Johnston M, Greenblatt JF, and Shilatifard A. 2001. COMPASS: a complex of proteins associated with a trithorax-related SET domain protein. Proc. Natl. Acad. Sci. USA 98, 12902-12907.
    Pubmed KoreaMed CrossRef
  20. Mishra K and Shore D. 1999. Yeast Ku protein plays a direct role in telomeric silencing and counteracts inhibition by rif proteins. Curr. Biol. 9, 1123-1126.
    Pubmed CrossRef
  21. Moretti P, Freeman K, Coodly L, and Shore D. 1994. Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 8, 2257-2269.
    Pubmed CrossRef
  22. Moretti P and Shore D. 2001. Multiple interactions in Sir protein recruitment by Rap1p at silencers and telomeres in yeast. Mol. Cell. Biol. 21, 8082-8094.
    Pubmed KoreaMed CrossRef
  23. Nislow C, Ray E, and Pillus L. 1997. SET1, a yeast member of the trithorax family, functions in transcriptional silencing and diverse cellular processes. Mol. Biol. Cell 8, 2421-2436.
    Pubmed KoreaMed CrossRef
  24. Oh J, Yeom S, Park J, and Lee JS. 2022. The regional sequestration of heterochromatin structural proteins is critical to form and maintain silent chromatin. Epigenetics Chromatin. 15, 5.
    Pubmed KoreaMed CrossRef
  25. Reuter G and Wolff I. 1981. Isolation of dominant suppressor mutations for position-effect variegation in Drosophila melanogaster. Mol. Gen. Genet. 182, 516-519.
    Pubmed CrossRef
  26. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, and Mesirov JP. 2011. Integrative genomics viewer. Nat. Biotechnol. 29, 24-26.
    Pubmed KoreaMed CrossRef
  27. Rossmann MP, Luo W, Tsaponina O, Chabes A, and Stillman B. 2011. A common telomeric gene silencing assay is affected by nucleotide metabolism. Mol. Cell 42, 127-136.
    Pubmed KoreaMed CrossRef
  28. Rudner AD, Hall BE, Ellenberger T, and Moazed D. 2005. A nonhistone protein-protein interaction required for assembly of the SIR complex and silent chromatin. Mol. Cell. Biol. 25, 4514-4528.
    Pubmed KoreaMed CrossRef
  29. Schotta G, Ebert A, Krauss V, Fischer A, Hoffmann J, Rea S, Jenuwein T, Dorn R, and Reuter G. 2002. Central role of Drosophila SU(VAR)3-9 in histone H3-K9 methylation and heterochromatic gene silencing. EMBO J. 21, 1121-1131.
    Pubmed KoreaMed CrossRef
  30. Shore D and Nasmyth K. 1987. Purification and cloning of a DNA binding protein from yeast that binds to both silencer and activator elements. Cell 51, 721-732.
    Pubmed CrossRef
  31. Singer MS, Kahana A, Wolf AJ, Meisinger LL, Peterson SE, Goggin C, Mahowald M, and Gottschling DE. 1998. Identification of high-copy disruptors of telomeric silencing in Saccharomyces cerevisiae. Genetics 150, 613-632.
    Pubmed KoreaMed CrossRef
  32. Taddei A, Hediger F, Neumann FR, Bauer C, and Gasser SM. 2004. Separation of silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins. EMBO J. 23, 1301-1312.
    Pubmed KoreaMed CrossRef
  33. Takahashi YH, Schulze JM, Jackson J, Hentrich T, Seidel C, Jaspersen SL, Kobor MS, and Shilatifard A. 2011. Dot1 and histone H3K79 methylation in natural telomeric and HM silencing. Mol. Cell 42, 118-126.
    Pubmed KoreaMed CrossRef
  34. Yeom S, Oh J, and Lee JS. 2022. Spreading-dependent or independent Sir2-mediated gene silencing in budding yeast. Genes Genom. 44, 359-367.
    Pubmed CrossRef


December 2022, 58 (4)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information