search for




 

Biochemical characterization of a PadR-type transcriptional regulator CmmRII in Streptomyces sp. SJ1-7
Korean J. Microbiol. 2023;59(1):1-7
Published online March 31, 2023
© 2023 The Microbiological Society of Korea.

Umji Choi1†, Maral Tsevelkhoroloo1†, Won-Jae Chi2, Soon-Kwang Hong1, and Chang-Ro Lee1,3*

1Department of Bioscience and Bioinformatics, Myongji University, Yongin 17058, Republic of Korea
2Microorganism Resources Division, National Institute of Biological Resources, Incheon 22689, Republic of Korea
3The Natural Science Research Institute, Myongji University, Yongin 17058, Republic of Korea
Correspondence to: *E-mail: crlee@mju.ac.kr; Tel.: +82-31-330-6472; Fax: +82-31-888-4911
These authors contributed equally to this work.
Received December 26, 2022; Revised January 11, 2023; Accepted January 12, 2023.
Abstract
Chromomycin A3 is an aureolic acid type antibacterial and antitumor compound produced by Streptomyces species. The biosynthetic gene cluster of chromomycin A3 is composed of more than 30 genes involved in polyketide biosynthesis and modification, sugar biosynthesis and transfer, and resistance, but the regulatory mechanisms of their expression are poorly understood. In this study, we analyzed biochemical features of the AfsR-type transcriptional regulator CmmRI and PadR-type transcriptional regulator CmmRII, which are located within the biosynthetic gene cluster of chromomycin A3 of Steptomyces sp. SJ1-7, isolated from soil surrounding the root of a Pinus densiflora plant in Sangju, South Korea. CmmRII interacted with several putative promoter regions of chromomycin A3 biosynthesis genes, whereas CmmRI interacted with no promoters tested. The presence of chromomycin A3 hardly affected the interaction between CmmRII and the promoter region. Purified CmmRII existed in as a monomeric form. These results imply that CmmRII is an important transcriptional factor in expression regulation of the biosynthetic gene cluster of chromomycin A3 in Steptomyces sp. SJ1-7.
Keywords : Streptomyces, chromomycin A3, gene expression, transcriptional regulator
Body

Chromomycin A3Streptomyces griseusStreptomyces 속 방선균이 생산하는 이차대사산물로 항균활성(antibacterial activity), 항진균활성(antifungal activity), 항바이러스활성(antiviral activity), 항암활성(antitumor activity)을 갖는 물질이다(Bianchi et al., 1997; Menéndez et al., 2004). Chromomycin A3는 오레올산(aureolic acid) 구조를 가진 물질로 DNA에 결합하여 DNA의 복제(replication)와 전사(transcription)를 억제하여 세포의 성장과 복제를 방해하는 물질이다(Menéndez et al., 2004, 2006). 또한, chromomycin A3는 DNA 분자에 결합하는 특징과 특정 파장의 빛에 반응하여 형광을 나타내는 특징을 가지고 있어 염색체 염색 등의 다양한 분야에 이용되고 있다(Kamiyama, 1968; Rahiminia et al., 2018; Nayeri et al., 2020).

Chromomycin A3S. griseus 외에도 토양과 바다를 포함한 다양한 환경에 존재하는 Streptomyces 속 방선균에서 합성이 된다고 보고가 되었다(Wu et al., 2007; Cho et al., 2020). 최근 한국의 상주(Sangju)에 있는 소나무(Pinus densiflora)의 뿌리에 존재하는 토양으로부터 chromomycin A3를 생산하는 Streptomyces sp. SJ1-7 균주가 동정이 되었고, 전체 유전자 서열이 분석되었다(Chi et al., 2021).

본 연구에서는 Streptomyces sp. SJ1-7 균주의 chromomycin A3 생합성 유전자 클러스터(biosynthetic gene cluster)내에 존재하는 두 전사조절인자(transcriptional regulator) CmmRI과 CmmRII의 생화학적 특징을 분석하는 연구를 수행하였다. 두 단백질을 순수 분리하여 chromomycin A3 생합성 유전자의 여러 프로모터(promoter)와의 결합여부를 분석하였다. 그 결과 CmmRII가 여러 프로모터와 강하게 결합한다는 사실을 알 수 있었다. 또한 CmmRII가 단량체(monomer)로 존재한다는 사실도 알 수 있었다. 그러므로 chromomycin A3 생합성 유전자 오페론 내에 존재하는 CmmRII가 chromomycin A3 생합성 유전자의 발현에 중요한 역할을 수행할 것으로 생각된다.

재료 및 방법

균주 배양과 플라스미드 제조

실험에 사용한 대장균(Escherichia coli) 균주는 lysogeny broth (LB) 배지에서 배양하였고, Streptomyces sp. SJ1-7 균주는 R2YE 배지에서 배양하였다. 필요할 때는 ampicillin 항생제를 최종농도가 100 μg/ml가 되게 공급하였다. Streptomyces sp. SJ1-7 균주에 존재하는 CmmRI과 CmmRII는 과발현하여 순수분리하기 위하여 각 유전자를 pET28a 플라스미드에 클로닝하였다. 실험 방법은 예전 논문에서 사용한 방법과 유사하다(Park et al., 2022). 간단히 설명하면, cmmRI 전체 유전자는 5'-CGCGCGGCAGCCATATGCAGGCGAACCACATCGT-3'와 5'-GCTCGAATTCGGATCCTCAGCCGGCCCGGCGGG TGG-3' primer를 사용하고 Streptomyces sp. SJ1-7 균주의 genomic DNA를 주형으로 하여 polymerase chain reaction (PCR)을 수행하였다. PCR 산물은 PCR purification kit를 이용하여 정제한 후, Ndel과 BamHI으로 자른 pET28a 플라스미드와 혼합하였다. 두 DNA는 In-Fusion® cloning (Clontech)의 recombinase를 이용하여 서로 연결하였다. ER2566 균주에 형질전환 후 pET28a-CmmRI 플라스미드를 가진 균주는 PCR을 통해 확인하였다. pET28a-CmmRI 플라스미드는 정제 후 시퀀싱(sequencing)을 통해 클로닝 성공 여부를 최종 확인하였다. cmmRII 전체 유전자에 대해서도 5'-CGCGCGGCAGCC ATATGGGACCGCTCCACGGCCA-3'와 5'-GCTCGAATTC GGATCCTCACGGTGATACCTCCGCTG-3' 두 종류의 primer를 이용하여 cmmRI과 동일한 방법으로 진행하였다.

CmmRI과 CmmRII 단백질 순수 분리

단백질 순수분리는 예전 방법과 유사하게 진행하였다(Kim et al., 2021). pET28a-CmmRI 또는 pET28a-CmmRII 플라스미드를 함유한 ER2566 세포는 LB 배지에서 37°C에서 배양하여 OD600 = 0.5에서 1 μg/ml isopropyl-β-D-thiogalactopyranoside (IPTG)를 첨가한 후 16°C에서 15시간 추가로 배양하였다. 배양한 균체를 원심분리하여 회수하였고, 세포를binding buffer (50 mM Tris-HCl; pH 8.0, containing 300 mM NaCl)에 분산한 후 French pressure cell을 이용하여 분쇄하였다. 분쇄된 세포를 20,000 × g로 20분간 원심분리한 후, 상등액에 존재하는 His-tagged CmmRI 또는 CmmRII 단백질을 TALON metal affinity resin (Clontech)을 이용하여 순수 분리하였다. Binding buffer로 resin을 여러 번 씻어준 후, elution buffer (50 mM Tris-HCl; pH 8.0, containing 200 mM imidazole and 300 mM NaCl)로 단백질을 resin으로부터 분리하였다. 분리된 단백질은 imidazole을 제거하기 위하여 2 L dialysis buffer (50 mM Tris-HCl; pH 8.0, containing 50 mM NaCl)에서 하룻밤 동안 투석(dialysis)하였다. 순수 분리한 단백질은 즉시 DNA와의 결합 여부를 분석하는 실험에 사용하였다.

CmmRI 단백질의 경우 위의 방법으로 순수 분리되지 않았기 때문에, 8 M urea로 denaturation시킨 후, resin에 붙인 상태에서 renaturation하여 순수 분리하였다. 원심분리한 후 바닥에 남은 pellet을 8 M urea로 분산한 후, 4°C에서 여러 번 vortexing하면서 inclusion body로 간 CmmRI을 denaturation하여 수용액에 녹도록 유도하였다. 용액을 20,000 × g로 20분간 원심분리한 후, 상등액에 존재하는 His-tagged CmmRI 단백질을TALON metal affinity resin에 붙여 주었다. Resin을 8 M, 4 M, 2 M, 1 M, 0.5 M urea로 차례로 씻어 준 후, 마지막으로 binding buffer로 세 번 씻어 주어 남아 있는 urea를 모두 없앴다. 이후에는 CmmRII와 동일하게 elution buffer로 단백질을 resin에서 분리한 후, 투석을 통해 imidazole을 제거한 후 단백질을 즉시 다음 실험에 사용하였다.

Electrophoretic mobility shift assay (EMSA)

Table 1에 제시되어 있는 primer를 사용하여 EMSA에 사용할 probe를 PCR을 통해 제작하였다. 각 probe는 타겟 유전자의 개시 코돈(start codon) 직전의 상위 약 300 bp를 포함하는 지역을 포함하도록 제작되었다. 대조군으로 사용한 UvrA probe는 uvrA 유전자 open reading frame (ORF) 내부의 300 bp 서열을 포함하도록 제작되었다. 순수분리한 CmmRI과 CmmRII를 이용한 EMSA 실험은 예전 실험 방법과 유사하게 진행하였다(Choi et al., 2016). 실험은 100 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM KCl, 2 mM DTT, 10% glycerol이 포함된 binding buffer에서 진행하였다. 모든 실험에는 대장균의 sonicated genomic DNA를 첨가하여 nonspecific competitor로 사용하였다. 1 μg의 DNA probe는 다양한 농도(0, 5, 10, 20 μg)의 단백질과 30°C에서 30분간 반응하였다. 반응물은 1% agarose gel에 loading한 후, 0.5 × Tris/Boric Acid/EDTA (TBE) buffer에서100 V로 전개한 후 ethidium bromide로 염색하였다.

Primer sequences used in this study
Primer names DNA sequences Use
MI-F GGCCCCCGGCCGCCCGCGAGAGGCTGCTGG MI probe
MI-R AGGAAACTCCGTGGGAGGGTCAGGAGGGCT
MII-F GTCCCGGGGTGGGGTGGCCTCCGTCGCGGA MII probe
MII-R CGATCTCTCCCGGCGTGAGAAGGCGCGCTG
MIII-F GGGCGTGGCACAGCACCGGTTTGTTCGCGA MIII probe
MIII-R GCTTCCTCCTGCGCGTTCGCCGGCCTGGTG
A-F GTTCACGGTGATACCTCCGCTGTGGGTCCG A probe
A-R CTTCACCCGCACCAGCGAACTGCCGACCCT
X-F ACGGGGAGGCACGGTCGTCGGCGAGGGCCC X probe
X-R ATGGTTCCTCAGCTCCTGTCCAGGACTCGG
UvrA-F TCCCGCGCACCCTCAAGGTCGCCGGGCTGA UvrA probe
UvrA-R GCTCGTCCAGGACGAAGATGATGCCGGTCA
CmmRI-F CGCGCGGCAGCCATATGCAGGCGAACCACATCGT pET28a-CmmRI construction
CmmRI-R GCTCGAATTCGGATCCTCAGCCGGCCCGGCGGGTGG
CmmRII-F CGCGCGGCAGCCATATGGGACCGCTCCACGGCCA pET28a-CmmRII construction
CmmRII-R GCTCGAATTCGGATCCTCACGGTGATACCTCCGCTG


CmmRII의 분자량 측정

CmmRII의 분자량은 gel filtration chromatography를 이용하여 분석하였다(Seo et al., 2020). Superose 12 10/300 GL column을 사용하였고, 100 mM NaCl이 첨가된 50 mM Tris-HCl (pH 8.0) buffer를 0.5 ml/min 속도로 흘려 주었다. 각 단백질의 용출 부피와 log10(분자량) 값 사이의 선형 그래프를 통해 CmmRII의 분자량이 측정되었다.

결과 및 고찰

CmmRI과 CmmRII 단백질 순수분리

Streptomyces griseus 균주의 chromomycin A3 생합성 유전자 오페론에는 전사조절인자(transcriptional regulator)로 추정되는 단백질이 2개(CmmRI과 CmmRII) 존재한다(Menéndez et al., 2004). CmmRI은 AfsR 타입 전사조절인자로, CmmRII는 PadR 타입 전사조절인자로 예측이 되었다(Fig. 1). 두 단백질이 전자조절인자로 예측이 되었지만, 실제로 전자조절인자로 작용하는지에 대한 분석은 아직까지 이루어지지 않았다. Streptomyces sp. SJ1-7 균주에도 S. griseus 균주와 유사한 chromomycin A3 생합성 유전자 오페론이 존재하고, 동일한 전사조절인자가 존재한다. 우리는 Streptomyces sp. SJ1-7 균주의 CmmRI과 CmmRII의 생화학적 특징을 분석하기 위하여 두 유전자를 pET28a 플라스미드에 클로닝하였다. N 말단에 6개의 histidine 아미노산을 첨가하여 단백질이 Talon metal affinity resin에 결합할 수 있도록 변형하였다. IPTG를 이용하여 16°C에서 단백질을 과발현하였을 때, 두 단백질 모두 충분히 과발현이 되었다(Fig. 2). Talon metal affinity resin을 이용하여 단백질을 순수분리하였을 때, 과량의 CmmRII가 순수분리 되었다(Fig. 2A). Cell debris를 원심분리후 supernatant와 pellet을 조사하였을 때, CmmRI 단백질 대부분이 pellet에 존재함을 알 수 있었다(Fig. 2B). 실험에 필요한 과량의 CmmRI 단백질을 순수분리하기 위해 pellet에 존재하는 CmmRI 단백질을 8 M urea를 이용하여 denaturation시켜 용해하였다. 8 M urea에 녹은 단백질을 Talon metal affinity resin에 붙인 후, urea 농도를 점차 낮추어서 단백질 구조를 refolding하는 방법을 통해 과량의 CmmRI 단백질을 순수분리 하였다(Fig. 2B).

Fig. 1. Genetic organization of the chromomycin A3 biosynthesis gene cluster. Arrows denote ORFs with corresponding gene names. The cmmRI and cmmRII genes are depicted as red arrows. The locations of probes for EMSA experiments are presented as green boxes.

Fig. 2. Purification of CmmRII and CmmRI. (A) CmmRII with a 6 x His-tag at its N-terminus was purified using a metal affinity chromatography and dialysis. Purified CmmRII was analyzed by SDS-PAGE using the Coomassie staining. Lanes: M, size marker; 1, cells before induction; 2, cells after induction; 3, purified CmmRII. (B) CmmRI with a 6 x His-tag at its N-terminus was purified using urea-mediated denaturation, metal affinity chromatography, and dialysis. Detailed experimental procedures were provided in Material and Method. Purified CmmRI was analyzed by SDS-PAGE using the Coomassie staining. Lanes: M, size marker; 1, cells before induction; 2, cells after induction; 3, supernatant after centrifugation; 4, pellet after centrifugation; 5, purified CmmRI.

EMSA 실험을 통한 전사조절인자와 프로모터의 결합력 분석

Chromomycin A3 생합성 유전자 오페론에서 프로모터로 추정되는 지역을 선정하여, 순수분리한 전사조절인자와의 결합여부를 EMSA를 통해 분석하였다. 프로모터 추정 지역 5개(MI, MII, MIII, A, and X probes)와 대조군으로 uvrA 유전자 ORF내부의 서열을 probe로 하여 EMSA를 수행하였다(Fig. 1). CmmRI은 고농도의 단백질이 존재할 때도 5개의 DNA 서열과 전혀 결합하지 않았다(Fig. 3). 그러나 CmmRII는 MI과 MII probe와는 강하게 결합하였고, A와 X probe와는 단백질 농도가 높을 때만 결합하였다(Fig. 4). CmmRII는 대조군으로 사용한 UvrA probe와는 단백질 농도에 상관없이 결합하지 않았다. 이런 결과는 CmmRII가 chromomycin A3 생합성 유전자 발현을 조절하는 중요한 전사조절인자임을 암시한다.

Fig. 3. The gel electrophoresis mobility shift assay between CmmRI and promoter regions of the chromomycin A3 biosynthesis genes. Mixtures of DNA probe (1 μg) of upstream sequences of the indicated genes and purified CmmRI (0, 5, 10, or 20 μg) were incubated in the binding buffer containing 100 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM KCl, 2 mM DTT and 10% glycerol, for 30 min at 30°C, and subsequently loaded onto 1% agarose gels. Gels were run in 0.5 × TBE buffer and stained with ethidium bromide. The region within ORF of the uvrA gene was used as a control probe.

Fig. 4. The gel electrophoresis mobility shift assay between CmmRII and promoter regions of the chromomycin A3 biosynthesis genes. Mixtures of DNA probe (1 μg) of upstream sequences of the indicated genes and purified CmmRII (0, 5, 10, or 20 μg) were incubated in the binding buffer containing 100 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM KCl, 2 mM DTT and 10% glycerol, for 30 min at 30°C, and subsequently loaded onto 1% agarose gels. Gels were run in 0.5 × TBE buffer and stained with ethidium bromide. The region within ORF of the uvrA gene was used as a control probe. Arrows indicate the shift band of DNA probe.

Chromomycin A3가 CmmRII와 프로모터의 결합에 미치는 영향

일반적으로 생합성 유전자의 발현이 최종 생산물에 의해 저해되기 때문에(Reitzer, 2003; Grove, 2017), chromomycin A3가 CmmRII의 작용에 미치는 영향을 분석하였다. CmmRII가 MI probe에 결합하는 조건에서 과량의 chromomycin A3를 첨가하였지만, CmmRII와 MI probe 사이의 결합에는 전혀 영향을 미치지 않았다(Fig. 5). 이를 통해 chromomycin A3가 직접 CmmRII의 기능에 영향을 미치지는 않는 것처럼 보인다.

Fig. 5. Effect of chromomycin A3 on the interaction between CmmRII and the promoter region of the MI gene. In the presence of various concentrations of chromomycin A3 (0, 1, 3, and 6 μg/ml), mixtures of DNA probe (1 μg) of the upstream sequence of the MI gene and purified CmmRII (20 μg) were incubated in the binding buffer containing 100 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM KCl, 2 mM DTT and 10% glycerol, for 30 min at 30°C, and subsequently loaded onto 1% agarose gels. Gels were run in 0.5 × TBE buffer and stained with ethidium bromide.

CmmRII의 stoichiometry 분석

순수분리한 CmmRII의 생화학적 특성을 분석하기 위하여 gel filtration chromatography를 이용하여 CmmRII의 분자량을 분석하였다. CmmRII는 Superose 12 10/300 GL column에서 21.441 kDa의 분자량을 가졌다(Fig. 6). 아미노산 서열을 통해 예측된 CmmRII의 분자량이 23.23 kDa이기 때문이 이런 결과는 CmmRII가 단량체(monomer)로 존재함을 의미한다. 수용액 상에서 단량체로 존재하고 DNA에 결합할 때도 단량체로 결합하는 전사조절인자도 있고(Peirano and Wegner, 2000; Himes et al., 2010), 수용액 상에서는 단량체로 존재하지만 DNA에 결합할 때는 이량체(dimer)로 결합하는 경우도 있기 때문에(Lee et al., 2006), CmmRII가 어떤 경우에 해당되는지는 더 연구가 필요할 것으로 생각된다.

Fig. 6. Determination of the molecular weight of CmmRII. Purified CmmRII was loaded onto a Superose 12 10/300 GL column and a flow rate of 0.5 ml/min was run. Molecular weight of CmmRII was calculated from the elution profile of size marker proteins: alcohol dehydrogenase, 200 kDa; bovine serum albumin, 66 kDa; carbonic anhydrase, 29 kDa; cytochrome c, 12.4 kDa. The position of the elution peak for CmmRII is indicated by an arrow.

본 실험을 통해 우리는 chromomycin A3 생합성 유전자 발현 조절인자인 CmmRII가 다양한 프로모터에 결합함을 보여주었다. 그리고 CmmRII가 수용액 상에서 단량체로 존재하는 전사조절인자임을 밝혔다. CmmRII 결손 균주의 경우 chromomycin A3 생산량이 야생종에 비해 증가한다고 알려져 있기 때문에 CmmRII는 repressor로 작용할 것으로 여겨진다 (Menéndez et al., 2007; Sun et al., 2018). 그러므로 본 실험을 통해 CmmRII가 chromomycin A3 생합성 유전자 발현에 중요한 역할을 수행하는 전사조절인자로 여겨지므로 추후 세부적인 작용 기작에 대한 연구가 필요할 것으로 생각된다. CmmRI의 경우 본 실험에서 어떤 프로모터와도 결합하지 않는 결과를 얻었지만, urea를 이용하여 순수 분리한 단백질의 경우 세포 내부에 존재하는 원래의 구조를 이루지 않는 경우도 있으므로 CmmRI의 기능에 대해서는 새로운 실험 방법을 통한 보다 정밀한 분석이 요구된다.

적 요

Chromomycin A3는 방선균이 생산하는 오레올산(aureolic acid) 구조를 가진 항균활성과 항암활성을 가진 물질이다. Chromomycin A3 생합성 유전자 클러스터(biosynthetic gene cluster)에는 폴리케타이드(polyketide) 생합성과 수정(modification), 당의 합성과 전달, 내성(resistance)에 관여하는 30개 이상의 유전자들이 존재지만, 유전자들의 발현 조절 기작에 대한 연구는 미미하다. 본 연구에서는 한국의 상주(Sangju)에 있는 소나무(Pinus densiflora)의 뿌리에 존재하는 토양으로부터 동정된 Streptomyces sp. SJ1-7 균주의 chromomycin A3 생합성 유전자 클러스터내에 존재하는 AfsR 타입 전사조절인자(transcriptional regulator) CmmRI과 PadR 타입 전사조절인자인 CmmRII의 생화학적 특징을 분석하였다. CmmRII는 chromomycin A3 생합성 유전자의 몇몇 프로모터(promoter)에 결합하였지만, CmmRI은 어떤 프로모터와도 결합하지 않았다. Chromomycin A3가 존재하는 것이 CmmRII와 프로모터와의 결합에 어떤 영향도 미치지 않았다. CmmRII는 단량체(monomer) 형태로 존재하였다. 이러한 실험은 CmmRII가 Streptomyces sp. SJ1-7 균주에서 chromomycin A3 생합성 유전자의 발현 조절에 중요한 역할을 수행하는 전사조절인자임을 알려준다.

감사의 말

본 연구는 환경부 국립생물자원관의 지원(NIBR202124101)과 농림축산식품부 농림식품기술기획평가원의 지원(322026-3)을 받아 수행되었다.

Conflict of Interest

Chang-Ro Lee is Editor of KJM. He was not involved in the review process of this article. Also, authors have no conflicts of interest to report.

References
  1. Bianchi N, Rutigliano C, Passadore M, Tomassetti M, Pippo L, Mischiati C, Feriotto G, and Gambari R. 1997. Targeting of the HIV-1 long terminal repeat with chromomycin potentiates the inhibitory effects of a triplex-forming oligonucleotide on Sp1-DNA interactions and in vitro transcription. Biochem. J. 326, 919-927.
    Pubmed KoreaMed CrossRef
  2. Chi WJ, Kim DS, Kim S, Choi ED, and Park SY. 2021. Draft genome sequence of Streptomyces strain SJ1-7, a soil bacterial isolate. Microbiol. Resour. Announc. 10, e01283-20.
    Pubmed KoreaMed CrossRef
  3. Cho E, Kwon OS, Chung B, Lee J, Sun J, Shin J, and Oh KB. 2020. Antibacterial activity of chromomycins from a marine-derived Streptomyces microflavus. Mar. Drugs 18, 522.
    Pubmed KoreaMed CrossRef
  4. Choi U, Park YH, Kim YR, Seok YJ, and Lee CR. 2016. Increased expression of genes involved in uptake and degradation of murein tripeptide under nitrogen starvation in Escherichia coli. FEMS Microbiol. Lett. 363, fnw136.
    Pubmed CrossRef
  5. Grove A. 2017. Regulation of metabolic pathways by MarR family transcription factors. Comput. Struct. Biotechnol. J. 15, 366-371.
    Pubmed KoreaMed CrossRef
  6. Himes P, McBryant SJ, and Kroos L. 2010. Two regions of Bacillus subtilis transcription factor SpoIIID allow a monomer to bind DNA. J. Bacteriol. 192, 1596-1606.
    Pubmed KoreaMed CrossRef
  7. Kamiyama M. 1968. Mechanism of action of chromomycin A3. J. Biochem. 63, 566-572.
  8. Kim YJ, Choi BJ, Park SH, Lee HB, Son JE, Choi U, Chi WJ, and Lee CR. 2021. Distinct amino acid availability-dependent regulatory mechanisms of MepS and MepM levels in Escherichia coli. Front. Microbiol. 12, 677739.
    Pubmed KoreaMed CrossRef
  9. Lee JH, Lequette Y, and Greenberg EP. 2006. Activity of purified QscR, a Pseudomonas aeruginosa orphan quorum-sensing transcription factor. Mol. Microbiol. 59, 602-609.
    Pubmed CrossRef
  10. Menéndez N, Braña AF, Salas JA, and Méndez C. 2007. Involvement of a chromomycin ABC transporter system in secretion of a deacetylated precursor during chromomycin biosynthesis. Microbiology 153, 3061-3070.
    Pubmed CrossRef
  11. Menéndez N, Nur-e-Alam M, Braña AF, Rohr J, Salas JA, and Méndez C. 2004. Biosynthesis of the antitumor chromomycin A3 in Streptomyces griseus: analysis of the gene cluster and rational design of novel chromomycin analogs. Chem. Biol. 11, 21-32.
    Pubmed CrossRef
  12. Menéndez N, Nur-e-Alam M, Fischer C, Braña AF, Salas JA, Rohr J, and Méndez C. 2006. Deoxysugar transfer during chromomycin A3 biosynthesis in Streptomyces griseus subsp. griseus: new derivatives with antitumor activity. Appl. Environ. Microbiol. 72, 167-177.
    Pubmed KoreaMed CrossRef
  13. Nayeri M, Talebi AR, Heidari MM, Seifati SM, and Tabibnejad N. 2020. Polymorphisms of sperm protamine genes and CMA3 staining in infertile men with varicocele. Rev. Int. Androl. 18, 7-13.
    Pubmed CrossRef
  14. Park SH, Choi U, Ryu SH, Lee HB, Lee JW, and Lee CR. 2022. Divergent effects of peptidoglycan carboxypeptidase DacA on intrinsic β-lactam and vancomycin resistance. Microbiol. Spectr. 10, e0173422.
    Pubmed KoreaMed CrossRef
  15. Peirano RI and Wegner M. 2000. The glial transcription factor Sox10 binds to DNA both as monomer and dimer with different functional consequences. Nucleic Acids Res. 28, 3047-3055.
    Pubmed KoreaMed CrossRef
  16. Rahiminia T, Yazd EF, Fesahat F, Moein MR, Mirjalili AM, and Talebi AR. 2018. Sperm chromatin and DNA integrity, methyltransferase mRNA levels, and global DNA methylation in oligoasthenoteratozoospermia. Clin. Exp. Reprod. Med. 45, 17-24.
    Pubmed KoreaMed CrossRef
  17. Reitzer L. 2003. Nitrogen assimilation and global regulation in Escherichia coli. Annu. Rev. Microbiol. 57, 155-176.
  18. Seo JW, Tsevelkhorloo M, Lee CR, Kim SH, Kang DK, Asghar S, and Hong SK. 2020. Molecular characterization of a novel 1,3-α-3,6-anhydro-L-galactosidase, Ahg943, with cold- and high-salt-tolerance from Gayadomonas joobiniege G7. J. Microbiol. Biotechnol. 30, 1659-1669.
    Pubmed KoreaMed CrossRef
  19. Sun L, Zeng J, Cui P, Wang W, Yu D, and Zhan J. 2018. Manipulation of two regulatory genes for efficient production of chromomycins in Streptomyces reseiscleroticus. J. Biol. Eng. 12, 9.
    Pubmed KoreaMed CrossRef
  20. Wu XC, Chen WF, Qian CD, Li O, Li P, and Wen YP. 2007. Isolation and identification of newly isolated antagonistic Streptomyces sp. strain AP19-2 producing chromomycins. J. Microbiol. 45, 499-504.


March 2023, 59 (1)