search for




 

Changes in Microcystis growth and toxin productivity according to chemical environmental factors in Korean reservoirs
Korean J. Microbiol. 2023;59(4):270-278
Published online December 31, 2023
© 2023 The Microbiological Society of Korea.

Kyoung-Hee Oh, Jae-Hun Lee, and Young-Cheol Cho*

Department of Environmental Engineering, Chungbuk National University, Cheongju 28644, Republic of Korea
Correspondence to: *E-mail: choy@chungbuk.ac.kr; Tel.: +82-43-261-3577; Fax: +82-43-264-2465
Received August 10, 2023; Revised November 21, 2023; Accepted November 23, 2023.
Abstract
To investigate the impact of environmental factors on the production of microcystins (MCs) and the growth of toxic Microcystis in Korean reservoirs, samples were collected during the occurrence of cyanobacterial blooming in Daechung (DC), Yongdam (YD), and Chungju (CJ) reservoirs, and environmental factors, MCs concentrations, and the numbers of total and toxic Microcystis were analyzed. The ratio of dissolved total nitrogen to dissolved total phosphorus was 18.0, 33.4, and 56.5, indicating that phosphorus rather than nitrogen is the limiting factor for cyanobacterial growth. In DC, the number of toxic Microcystis, the proportion of toxic Microcystis among total Microcystis, and MCs concentrations were approximately three times higher than those in CJ. These results suggest that the growth of toxic Microcystis differed due to environmental differences between the two lakes, but did not affect the MCs production per cell of Microcystis. While the number of toxic Microcystis in DC and YD samples was almost the same, the MCs concentration in DC was about four times higher, indicating that the toxin-producing ability of toxic Microcystis in Daechung Reservoir is higher than that in Yongdam Reservoir. In order to clearly elucidate the phenomenon of differences in the growth of toxic Microcystis and toxin production per cell in response to changes in environmental factors in reservoirs, more research is deemed necessary.
Keywords : Korean reservoirs, microcystins, realtime PCR, toxigenic Microcystis, toxin productivity
Body

부영양화된 호수에서 남조류 과다증식 현상(이하, 녹조 현상)을 일으키는 대표적인 남조류는 Microcystis, Dolichospermum (Anabaena), Planktothrix (Oscillatoria), Nostoc, Aphanizomenon, Raphidiopsis (Cylindrospermopsis) 속에 속하는 것으로, 하절기에 국내 대부분의 호소에서는 이들 중 Microcystis spp.가 우점하고 있다(Son et al., 2018; Joo et al., 2020; Ibelings et al., 2021). 녹조는 냄새물질을 발생시켜 물의 이용도를 감소시키며, microcystins (MCs), anatoxins와 같은 독소를 생산하여 가축의 죽음과 인간에게 질병을 일으키기도 한다(Vu et al., 2020; Mustapha et al., 2021; Li et al., 2022). 국내 호소에서 녹조 발생시 주로 발견되는 MCs는 7개의 아미노산으로 구성된 간독소이며, 이를 구성하는 아미노산의 종류 및 변이에 따라 270종 이상이 있는 것으로 알려져 있다(Oh et al., 2013; Bouaïcha et al., 2019; Massey and Yang, 2020; Saleh et al., 2021).

수환경에서 남조류의 생장 및 MCs의 생산에 미치는 환경 요인의 변화에 대한 다수의 연구가 진행되었다. 남조류의 생장은 수체의 유속, 체류시간과 같은 물리적 요인과 화학적 요인, 다른 수생 생물과의 경쟁이나 천이와 같은 생물학적 요인에 의해 영향을 받는다(Kozak et al., 2019; Plaas and Paerl, 2021). 화학적 요인 중 인(phosphorus, P)과 질소(nitrogen, N)와 같은 영양 염류의 농도, 이들의 존재 형태 및 비율(N/P)이 가장 중요한 것으로 알려져 있다(Kolzau et al., 2014; Andersson et al., 2015; Berg and Sutula, 2015). 수체에서 MCs 생산은 클로로필-a, 인(P), 질소(N)의 농도 및 N/P 비율 등과 같은 환경요인의 변화와 관련성이 있으며, 하나의 요인이 아니라 다수의 환경요인이 복합적으로 작용하는 것으로 알려져 있다(Edwin et al., 2005; Rinta-Kanto et al., 2009; Liu et al., 2022).

국내에서는 호소 및 하천의 수질 변화를 모니터링하기 위하여 수질측정망을 운영하고 있으며, 무기질소(NH4+-N, NO2N, NO3--N; inorganic nitrogen; IN), 인산염 인(PO43--P; inorganic phosphorus; IP), 총질소(total nitrogen; TN), 총인(total phosphorus; TP)과 같은 영양염류에 대한 분석이 수행되고 있다(Kim et al., 2021). 이러한 물질의 분석 결과는 외부 또는 내부 오염원으로부터 물질의 유입 정도를 파악할 수 있으나, 수체 내에서 조류의 생장과 관련된 영양 염류의 순환에 대한 정보를 제공하지는 못한다. Alkaline phosphatase (APase)는 미생물의 생장에 필요한 인이 부족할 때 세포 외로 배출되는 효소로서 수체 중 인산염 인의 부족을 판단하는 지표로 사용될 수 있으며(Vrba et al., 2018; Wang et al., 2021), 여과 분획(fractionation)을 통하여 수생태계의 주요 구성원인 조류와 세균의 인에 대한 친화도를 예측하는 데에도 활용할 수 있다(Cho et al., 1993; Ma et al., 2019; Zhou et al., 2021).

국내에서는 녹조 현상으로 인한 상수원수 및 친수용수의 안전성을 확보하기 위하여 조류경보제를 운영하고 있으며, 유해 남조류(Microcystis, Anabaena, Oscillatoria, Aphanizomenon 속 남조류) 세포수 밀도를 발령 기준으로 사용하고 있다(Jung et al., 2019). 유해 남조류로 분류된 남조류 중에는 독소를 생산하는 것과 생산하지 않는 것이 혼재되어 있으며, 각각의 독소 생산능도 차이가 큰 것으로 알려져 있다(Vaitomaa et al., 2003; Downing et al., 2005; McQuaid et al., 2011; Swe et al., 2021). 따라서 남조류가 생산하는 독소에 대한 효율적인 위해 관리를 위하여 유해남조류 중 독소생산 남조류의 분율 및 독소 생산능에 대한 검토가 필요하다.

본 연구에서는 상수원으로 사용되는 국내 호수에서 녹조 발생 시기에 채취한 시료를 대상으로 실시간 PCR법을 사용한 남조류, Microcystis 및 독소 유전자를 가진 Microcystis의 계수, MCs 농도의 정량, APase의 활성도 분석을 통하여, 지점에 따른 환경요인의 차이가 독소 생산 남조류의 분율, 독소 생산능, APase의 활성에 미치는 영향을 규명하고자 하였다.

재료 및 방법

수도권 및 중부권의 대표적인 상수원인 대청호, 충주호, 용담호에서 녹조 발생 시기에 각각 수시료를 채취하였다(Table 1). 대청호에서는 추소리 지점(대청호 조류경보제 관찰 지점)에서 2008년 7월 1일에 채취하였으며, 용담호에서는 중상류에 위치한 용평대교 지점에서 2008년 6월 27일에 채취하였다. 충주호 시료는 충주호 지류인 제천천 하류의 하천대교 지점에서 2008년 9월 2일에 채취하였다. 제천천 하류에서는 국내 다른 호소와 달리 9월 이후에 녹조가 발생하는 특성이 있다(Jeon et al., 2022). 채취된 시료에서 수온, pH, TN, 입자성 총질소(particulate TN, PTN), 용존성 총질소(dissolved TN, DTN), TP, 입자성 총인(particulate TP, PTP), 용존성 총인(dissolved TP, DTP), IP, 클로로필-a의 농도를 수질오염공정시험기준(MOE, 2016)에 따라 분석하였다.

Location of sampling and the water quality of samples
Reservoir Daechung Yongdam Chungju
Location 36°21′34.17″ N 35°52′33.15″ N 37°01′50.98″ N
127°34′10.38″ E 127°30′31.95″ E 128°02′16.82″ E
Date of sampling Jul. 1, 2008 Jun. 27, 2008 Sep. 2, 2008
Water temperature (°C) 27.0 28.5 27.5
pH 8.66 9.73 9.99
Chlorophyll-a (mg/m3) 82.5 40.6 64.2
Total nitrogen (TN; mg-N/L) 1.54 (± 0.020)a 0.975 (± 0.004) 1.12 (± 0.023)
Particulate TN (mg-N/L) 0.335 (± 0.013) 0.218 (± 0.005) 0.403 (± 0.013)
Dissolved TN (mg-N/L) 1.21 (± 0.007) 0.757 (± 0.002) 0.717 (± 0.011)
Total phosphorus (TP; mg-P/L) 0.208 (± 0.006) 0.326 (± 0.073) 0.0825 (± 0.001)
Particulate TP (mg-P/L) 0.141 (± 0.001) 0.303 (± 0.074) 0.0698 (± 0.001)
Dissolved TP (mg-P/L) 0.0671 (± 0.005) 0.0227 (± 0.001) 0.0127 (± 0.003)
PO43--P (μg-P/L) 7.23 (± 0.90) 7.62 (± 0.00) 9.22 (± 0.90)

aNumbers in parentheses indicate standard deviation



APase의 활성도 및 농도 분석을 위한 기질은 4-methylumbelliferyl phosphate (MUP)를 사용하였다(Cho et al., 1993; Susini et al., 2018). 환경시료를 각각 GF/C 여과지(Whatman)와 0.22 μm 공극의 여과지(mixed cellulose ester; Advantec)로 여과한 후, 여과된 시료와 여과되지 않은 원시료에 각각 MUP를 최종농도 2.5~100 μM로 주입한 후, 30°C에서 30분간 진탕 배양하였다. 반응 후 glycine buffer (1M, pH 10.5)를 첨가하여 반응액의 pH를 10이 되도록 한 후, 형광광도계(TD-360, Turner Designs)를 사용하여 생성된 4-methylumbelliferone (MUF)의 양을 구하였다. MUF의 생성속도로부터 계산된 반응속도(1/V)와 기질의 농도(1/[s])를 도식한 후, Michaelis 상수(substrate half-saturation constant, Km)과 최대 전환 속도(Vmax)를 구하였다. APase의 양은 시판되는 APase (Promega)와 MUP를 각각 0~3.0 mU/ml와 100 μM을 첨가한 시료로부터 작성된 검량선으로부터 구하였다(Oh, 2009). 여과되지 않은 원시료와 GF/C 여과지로 여과한 시료에서 측정된 결과의 차이는 조류의 체내와 조체에 부착된 APase(조류 APase)로 분류하였으며, GF/C 여과지와 0.22 μm 공극 여과지로 여과된 시료의 차이는 세균에 포함되거나 부착된 APase(세균 APase)로 분류하였다. 0.22 μm 공극 여과지로 여과된 시료에서 측정된 값은 용존성 APase로 구분하였다(Cho et al., 1993; Ma et al., 2019; Zhou et al., 2021).

시료에 포함된 MCs의 농도를 분석하기 위하여, 수시료를 GF/C 여과지로 여과하였다. 여과지에 5% acetic acid를 넣고 초음파 파쇄기(Ultrasonic Processor; KFS-150N, 한국코프로텍)로 40 W에서 5분간 처리한 후, 4°C에서 12시간 동안 독소를 추출하였다. 이를 원심분리하여 부유물을 제거하고, 상징액에 포함된 MCs를 C-18 column (Sep-Pak Vac 3 cc; Waters)으로 정제하였다. 컬럼에 상징액을 첨가한 후 20% methanol로 세척하였으며, 100% methanol로 용리하였다. 정제된 시료에 포함된 methanol을 질소 가스(99.99%) 하에서 evaporator (Hurricane-Lite; 청민테크)를 사용하여 완전히 제거하였다. 다시 소량의 100% methanol을 첨가하여 MCs를 녹이고 syringe filter (0.2 μm PTFE; Advantec)를 사용하여 농축액에 포함된 입자를 제거하였다.

MCs의 분석은 PDA 검출기(Waters 2998, Waters)와 autosampler (Waters 2707)가 장착된 HPLC (Waters 1525)를 사용하였으며, 결과 분석을 위하여 Empower Pro 프로그램을 사용하였다. 사용한 column은 Xterra RP18 column (5 μm particle size, 15 cm × 3.9 mm I.D.; Waters)이었다. 유동상은 0.05% (v/v) tri-fluoroacetic acid가 포함된 acetonitrile/water를 사용하였고, 유동상 이동속도는 0.8 ml/min이었다. MCs의 종류별 분석을 위하여 표준 MC-LR, -YR, -RR을 Sigma-Aldrich Co.로부터 구입하여 사용하였다.

환경시료로부터 DNA의 추출 및 정제는 Oh et al. (2013)의 방법을 사용하였으며, DNA의 정량은 Quant-iTTM Picogreen dsDNA Reagent (Invitrogen)를 사용하였다. 환경시료에서 남조류와 Microcystis의 16S rRNA 유전자 copy 수와 독성 Microcystis가 가지고 있는 microcystin 생합성 유전자(mcyA gene)의 copy 수는 실시간 PCR법으로 계수하였다(Table 2; Oh et al. (2013), 2013).

PCR primers used in this study
Target Name Sequence (5'→3') Reference
Cyanobacterial 16S rRNA gene 16SCF GGCAGCAGTGGGGAATTTTC Oh et al. (2012)
16SUR GTMTTACCGCGGCTGCTGG
Microcystis 16S rRNA genea 16SMTb CGCCGCGTGAGGGAGGAAGGTC
Microcystis mcyA gene mcyAMF2 CTCCCAGAATACATGATACC Oh et al. (2013)
mcyAMR2 CCCAAAACTTCAGCCCAAAT

a16S rRNA gene copy of Microcystis spp. was quantified simultaneously with that of cyanobacteria.

bFluorochromes, CAL Fluor Gold 540 and BHQ-1, were attached at 5’ and 3’ end, respectively.


결과 및 고찰

대청호, 용담호, 충주호 시료에서 pH는 각각 8.66, 9.73, 9.99로 약알칼리성을 나타내었다(Table 1). pH의 변화는 미세조류의 생장에 영향을 미친다. Microcystis aeruginosa의 경우 pH 5.0에서는 생장이 제한되며, 중성 또는 약알칼리성 pH (7.0~9.0)에서는 다른 조류에 비해 우점하게 된다(Yang et al., 2018). Microcystis aeruginosa의 증식이 멈추는 시기에 pH는 약 10이며, 생장하기 위한 최적 pH는 9.56으로 알려져 있다(Wei et al., 2022). 따라서 용담호와 충주호 시료의 경우 Microcystis 속 남조류의 증식이 최대인 상태로 보이며, 대청호의 경우에는 증식 단계인 것으로 판단할 수 있다. 대청호, 용담호, 충주호 시료에서 수온은 각각 27.0, 28.5, 27.5°C로 측정되었다(Table 1). 남조류의 최적 생장 온도는 20~30°C이기 때문에 수온이 20°C 이상인 하절기에 호소에서 우점하게 된다(Berg and Sutula, 2015). 연구대상 지점의 수온은 25°C 이상으로 남조류의 생장에 적합한 수온을 나타내었다.

대청호, 용담호, 충주호 시료에서 TP의 농도는 각각 0.208 (± 0.006), 0.326 (± 0.073), 0.0825 (± 0.001) mg-P/L로 용담호 시료에서 가장 높았으며, PTP의 농도도 각각 0.141 (± 0.001), 0.303 (± 0.074), 0.0698 (± 0.001) mg-P/L로 같은 경향을 나타내었다(Table 1). DTP에 비해 PTP의 비율이 높았으며, TP 중 PTP의 비율은 용담호(93.0%) > 충주호(84.6%) > 대청호(67.7%)의 순이었다. 녹조 발생 시기에 수시료에서 측정된 PTP와 PTN은 주로 조체로부터 기인하며(Shi et al., 2020), 수체에서 클로로필-a와 TP의 농도는 상관관계가 있는 것으로 알려져 있다(Stow and Cha, 2013). 대청호, 용담호, 충주호 시료에서 클로로필-a의 농도는 각각 82.5, 40.6, 64.2 mg/m3으로 용담호에 비해 대청호에서 높았으나, TP의 농도는 대청호에 비해 용담호에서 높았다. 클로로필-a와 인의 농도의 상관관계는 수리학적 인의 부하와 호수의 모양 등에 의해 다를 수 있으며(Olsen and Jones, 2022), Microcystis spp.에서 생장속도에 따라 세포당 인의 함량이 3.5배까지 변할 수 있는 것으로 알려져 있기 때문에(Saxton et al., 2012), 이들 시료에서 클로로필-a와 TP의 상관관계를 직접적으로 비교하기는 어렵다. 다만 TP와 클로로필-a에 대한 OECD의 부영향화 기준(Vollenweider and Kerekes, 1982)에 따르면 모든 시료가 부영양(eutrophic) 또는 과영양(hypertrophic) 상태이므로 수질관리가 필요한 것으로 판단된다.

IP (PO43--P)의 농도는 대청호, 용담호, 충주호 시료에서 각각 7.23 (± 0.90), 7.62 (± 0.00), 9.22 (± 0.90) μg-P/L로 TP에 비해 매우 낮았으며, TP 중 IP의 비율은 각각 3.48, 2.34, 11.2%이었다(Table 1). 또한 DTP 중 IP의 비율은 각각 10.8, 22.6, 72.6%이었다. TN의 농도는 대청호, 용담호, 충주호 시료에서 각각 1.54 (± 0.020), 0.975 (± 0.004), 1.12 (± 0.023) mg-N/L로 대청호 시료에서 가장 높고 충주호, 용담호 순이었다. TN 중 DTN의 비율은 대청호(78.3%) > 용담호(77.7%) > 충주호(64.0%)의 순이었다. 연구 대상 지점에서 DTP의 농도는 낮은 반면 DTN의 농도가 높게 나온 것은 질소가 외부 오염원으로부터 유입되었음을 의미하는 것이므로, 축산 시설 등 질소 오염원에 대한 관리가 필요한 것으로 보인다.

대청호, 용담호, 충주호 시료에서 DTN과 DTP의 비율은 각각 18.0, 33.4, 56.5로 매우 높았다(Fig. 1). 질소와 인의 질량비가 7을 초과하면 인이 조류 생장의 제한요인으로 작용하며, 7 미만이면 질소가 제한요인인 것으로 알려져 있다(Kolzau et al., 2014). 따라서 본 연구대상 지점에서는 질소 보다는 인이 조류 생장의 제한 요인으로 작용하는 것으로 보인다. 하지만 일부 연구에 따르면 N/P 비율이나 인의 농도 보다 질소가 높은 농도일 때 남조류의 생장이 촉진되어 녹조가 발생하는 것으로 알려져 있다(Paerl et al., 2011; Huisman et al., 2018).

Fig. 1. Concentrations of dissolved total nitrogen (DTN), particulate total nitrogen (PTN), dissolved total phosphorus (DTP), and particulate total phosphorus (PTP) in the samples.

대청호와 용담호 시료에서 APase의 농도를 측정한 결과, 각각 0.053, 0.420 mU/ml로 용담호 시료에서 7.9배가 높았다 (Table 3; Fig. 2). 조류가 생산하는 APase의 농도는 각각 0.027, 0.171 mU/ml이었으며, 전체 APase 중 각각 50.2와 40.8%이었다. 대청호 시료에서는 세균에 비해 조류가 생산하는 APase가 3.9배 많았으나, 용담호 시료에서는 두 값이 거의 유사하였다. 두 지점에서 측정된 APase의 최대반응속도(Vmax)는 각각 0.251, 1.759 μM/h로 용담호 시료에서 약 7배 높았으나, 이는 APase의 활성도 차이 때문이 아니라, 용담호 시료에서 APase의 농도가 높기 때문인 것으로 판단된다.

Fig. 2. Concentrations of alkaline phosphatase (APase) in the samples taken from Daechung and Yongdam Reservoirs.
Subtracting the soluble and the bacterial fraction from the total APase concentration was classified as the algal fraction, and the bacterial fraction was obtained by subtracting the soluble fraction from the concentration of APase measured in the sample filtered with GF/C filter. Soluble fraction was the concentration of APase measured in the sample filtered with 0.22 μm pore-sized filter paper.

Kinetic parameters and concentrations of alkaline phosphatase (APase) in the samples
Reservoir Fraction Kma (µM) Vmaxa (µM/h) APase (mU/ml)
Daechung Wholeb 110.440 0.251 0.053
Algalc 697.110 0.135 0.027
Bacteriald 7414.100 0.035 0.007
Solublee 495.200 0.099 0.020
Yongdam Whole 0.242 1.759 0.420
Algal 2.628 0.736 0.171
Bacterial 0.807 0.691 0.165
Soluble 3.829 0.337 0.084

a Substrate half-saturation constant (Km) and maximum reaction rate (Vmax).

b Parameters were estimated using the raw samples.

c Parameters were calculated from the data with GF/C filtered and raw samples.

d Parameters were calculated from the data with 0.22 μm pore-sized filter and GF/C filtered samples.

e Parameters were estimated using 0.22 μm pore-sized filtered samples.



두 지점의 시료에서 IP의 농도는 각각 7.23, 7.62 μg-P/L로 거의 유사한 값을 나타내었으나, APase의 농도 및 활성도 차이가 크게 나타나는 것은 각 시료에 있는 조류의 조성 차이 때문인 것으로 판단된다. 남조류인 M. aeruginosa와 규조류인 Synedra capitata에서 APase의 활성도를 비교한 결과, Microcystis의 활성이 Synedra에 비해 33배 큰 것으로 나타났다(Giraudet et al., 1997). 인 제한 상태에서 Aphanizomenon에 비해 Noduralia가 생산하는 APase의 Km이 작고 Vmax가 큰 것으로 측정되었다(Degerholm et al., 2006). 이와 같이 APase의 활성도는 수체에서 인 제한도를 평가하는 지표 뿐만 아니라, 각 조류 종에 대한 APase의 Km과 Vmax의 자료가 확보된다면 조류의 군집 구조를 평가하는 지표로 사용될 수 있을 것으로 판단된다. 현재 국내에서 운영되고 있는 조류경보제 측정망에서는 수시료 중 TP, DTP, IP의 농도를 모니터링 하고 있다. APase는 IP가 부족할 때 분비되는 세포외 효소로서 미생물의 생장에 따른 IP의 필요 정도를 예측하는 지표로 사용될 수 있다(Vrba et al., 2018; Wang et al., 2021). 따라서 조류경보제 측정망에서 인의 농도 뿐만 아니라 APase의 농도 및 활성도를 측정한다면 녹조 발생 강도를 예측하는데 활용될 수도 있을 것으로 판단된다.

대상 지점에서 녹조 발생 시기에 채취된 시료의 클로로필-a 농도는 33.7~64.2 mg/m3으로 매우 높았다(Table 1). 실시간 PCR을 사용하여 시료 중 남조류의 16S rRNA 유전자 copy 수를 측정한 결과, 1.05~7.35 × 109 copies/L의 범위로 측정되었다(Table 4). 대청호 시료에서 클로로필-a 농도가 가장 높았지만, 충주호 시료에 비해 남조류 16S rRNA 유전자 copy 수가 낮게 나왔다. 단위 클로로필-a의 농도 당 남조류의 16S rRNA 유전자 copy 수는 대청호, 용담호, 충주호 시료에서 각각 34.3, 25.9, 115 copies/μg of 클로로필-a로 대청호와 용담호 시료에서는 비슷한 값을 나타낸 반면 충주호 시료에서 높은 값을 나타내었다.

Concentrations of microcystins, gene copies of 16S rRNA gene of cyanobacteria and Microcystis spp., and gene copies of mcyA in microcystin synthesis gene cluster
Reservoir Daechung Yongdam Chungju
Microcystins (μg/L) 48.6 11.0 14.2
Gene copies (×106 copies/L) Cyanobacterial 16S rRNA gene 2,829 (± 78.2)a 1,053 (± 79.7) 7,352 (± 312.0)
Microcystis 16S rRNA gene 1,654 (± 140.1) 701.2 (± 11.2) 5,409 (± 677.4)
mcyA gene 281.0 (± 52.9) 254.1 (± 63.6) 81.10 (± 37.6)

aNumbers in parentheses indicate standard deviation



남조류 세포당 16S rRNA 유전자의 copy 수는 남조류의 속 마다 다르며, 대체적으로 1~5개이다(Schirrmeister et al., 2012). 이형세포(heterocyst)와 같이 분화세포를 만드는 남조류는 세포 당 4~5개의 16S rRNA 유전자 copy를 포함하고 있다. Microcystis spp.는 세포당 2 copy를 포함하고 있으며, Anabaena spp.는 4~5 copies/cell, Synechococcus spp.는 1~2 copies/cell의 16S rRNA 유전자를 포함하고 있다(Schirrmeister et al., 2012; Oh et al., 2013).

대청호, 용담호, 충주호 시료에서 남조류의 16S rRNA 유전자 copy 수 중 Microcystis의 16S rRNA 유전자 copy 수가 차지하는 비율은 각각 58.5, 66.6, 73.6%로 남조류 중 Microcystis spp.가 높은 비율을 나타내었다(Table 4; Fig. 3). 세 지점에서 Microcystis spp.가 같이 우점함에도 불구하고, 대청호 또는 용담호에 비해 충주호 시료에서 단위 클로로필-a의 농도당 16S rRNA 유전자 copy 수가 높은 것은 대청호 또는 용담호 시료에서 남조류 이외의 조류로 인해 클로로필-a의 농도가 높게 측정되었기 때문인 것으로 판단된다. Phycocyanin은 남조류가 특이적으로 생산하는 보조 광합성 색소로 이의 농도는 남조류의 생체적과 상관성이 높은 것으로 알려져 있다(McQuaid et al., 2011; Padisák et al., 2021). 따라서 클로로필-a와 phycocyanin 농도를 같이 측정하면 녹조가 발생한 시료에서 남조류의 비율을 이해하기 용이할 것으로 판단된다.

Fig. 3. Number of gene copies of cyanobacterial and Microcystis 16S rRNA genes in the samples.

실시간 PCR을 통하여 Microcystis의 독소 생산 유전자의 copy 수를 계수한 결과, 대청호, 용담호, 충주호 시료에서 각각 2.81, 2.54, 0.81 × 108 copies/L로 대청호와 용담호 시료에서 비슷한 값이었으며, 충주호에서는 낮은 값을 나타내었다(Table 4; Fig. 4). 선행연구에 따르면 Microcystis는 2 copies/cell의 16S rRNA 유전자를 가지고 있으며, 독소 생산 Microcystis는 1 copy/cell의 독소생산 유전자(mcy gene cluster)를 가지고 있었다(Oh et al., 2013). Microcystis의 16S rRNA 유전자 copy 수와 독소 유전자의 copy 수 결과 및 세포 당 이들 유전자의 copy 수로부터 Microcystis 및 독성 Microcystis의 세포수 밀도를 계산한 결과, 대청호, 용담호, 충주호에서 총 Microcystis 중 독소생산 Microcystis 세포수의 비율은 각각 34.0, 72.5, 3.00%이었다.

Fig. 4. Cell numbers of Microcystis and toxic Microcystis and the concentration of microcystins in the samples.
The cell number of Microcystis was calculated from the copy number of 16S rRNA gene of Microcystis estimated using realtime PCR and cell quota of 16S rRNA gene in Microcystis. The number of toxic Microcystis was calculated from the copy number of mcyA gene estimated using realtime PCR and cell quota of this gene in potentially toxic Microcystis.

시료 중 MCs의 농도는 대청호, 용담호, 충주호 시료에서 각각 48.6, 11.0, 14.2 μg/L로 대청호 시료에서 가장 높았다 (Table 4; Fig. 4). 시료 중 MCs의 농도와 독성 Microcystis의 세포수로부터 독성 Microcystis 당 생산하는 MCs의 양을 계산한 결과, 각각 0.173, 0.0433, 0.175 pg/cells로 대청호와 충주호는 비슷한 반면 용담호는 다른 시료에 비해 1/4 정도의 독소 생산력을 나타내었다. 선행 연구 결과에 따르면, 독성 Microcystis의 MCs 생산능은 0.2 pg/cell인 것으로 알려져 있으며(McQuaid et al., 2011), 질소가 제한된 조건에서 세포당 독소 생산능은 Microcystis의 생장속도와 비례하는 것으로 나타났다(Long et al., 2001). 국내의 4대강에 건설된 4개의 보에서 독성 Microcystis 세포당 MC-LR의 생산능을 분석한 결과, 지점 및 시기에 따라 달랐으며 평균의 최대값은 0.103 pg MC-LR/cell이었다 (MOE, 2017). 이에 따라 대청호 및 충주호 시료에서 독성 세포당 MCs의 생산능은 국외의 결과에 비해 낮지만 국내 선행 연구의 결과보다 높은 값을 나타내었으며, 용담호 시료에서는 다른 지점에 비해 매우 낮은 값을 나타내었다.

본 연구 대상인 3개의 지점에 대한 독성 관련 결과를 분석한 결과, 충주호에 서식하는 독성 Microcystis의 독소 생산능은 대청호와 비슷하나, 전체 Microcystis 중 독성 Microcystis의 비율이 낮았으며, 용담호의 경우에는 독성 Microcystis의 비율이 매우 높았으나 세포 당 독소생산력이 낮았다. 대청호와 충주호를 비교해 볼 때, 대청호의 독소생산 Microcystis의 수와 독소 농도가 충주호에 비해 약 3배 이상 많았지만, 독성 Microcystis 세포당 독소 생산능은 거의 유사하였다. 따라서 두 지점에서 독소 생산 유전자의 활성도는 비슷한 것으로 보인다. 대청호와 용담호의 결과를 비교하면, 독소생산 Microcystis의 세포수 밀도는 비슷하게 나타났으나, MCs의 농도는 용담호가 대청호에 비해 1/4배 정도로 낮았다. 이는 용담호에 서식하는 독성 Microcystis의 독소생산 유전자의 활성이 대청호 서식 종에 비해 낮기 때문인 것으로 추측된다.

국내에서 운영되는 조류경보제의 발령기준은 WHO의 잠재적 먹는물 관리기준인 1.0 μg MC-LR/L에 대하여 독성 Microcystis의 독소 생산능(0.2 pg MC-LR/cell)을 적용하여 계산된 5,000 cells/ml을 “경보” 단계 기준으로 설정하였다(Izydorczyk et al., 2009; Park et al., 2011). 2014년 개정된 조류경보제에서 국내 상수원수에는 독성이 가장 강한 MC-LR 보다는 MC-RR의 비율이 높으며, 독성 Microcystis의 독소 생산능이 0.2 pg MC-LR/cell 보다 낮았기 때문에, “경계” 단계의 발령 기준을 10,000 cells/ml로 설정하였다(Oh et al., 2012; Lee et al., 2018). 하지만 용담호와 같이 일부 호소에서 서식하는 유해 남조류의 독소 생산능은 매우 낮으며, 총 Microcystis 중 독소생산 유전자를 포함한 Microcystis의 비율이 3.00~72.5%로 변이가 매우 큰 것으로 나타났다. 상수원에서 발생하는 녹조로부터 먹는물의 안전성을 확보하기 위해 실시되는 조류경보제의 효율적 운영을 위하여 국내 상수원으로 사용되는 호소에 대해 남조류 중 독성 남조류의 분율 및 독소 생산능에 대한 광범위한 모니터링을 실시하여, 발령 기준을 재검토할 필요가 있다.

적 요

국내 호소에서 환경요인의 차이가 남조독소인 마이크로시스틴(MCs) 생성과 독성 Microcystis의 생장에 미치는 영향을 조사하기 위하여, 대청호(DC), 용담호(YD), 충주호(CJ)에서 녹조 발생 시기에 채취한 시료에서 환경 요인 및 총 Microcystis, 독성 Microcystis의 수와 MCs 농도를 분석하였다. 세 지점에서 용존성 총질소와 용존성 총인의 비율은 각각 18.0, 33.4, 56.5를 나타내어 질소 보다는 인이 조류 생장의 제한 요인으로 작용하는 것으로 판단된다. DC에서 독성 Microcystis의 수, 총 Microcystis 중 독성 Microcystis의 비율 및 MCs 농도는 CJ에 비해 약 3배 정도 높은 것으로 나타났다. 이러한 결과는 두 호수에서 환경 요인 차이로 인해 독성 Microcystis의 생장이 차이가 있었으나, Microcystis의 세포 당 MCs 생성능에는 영향을 주지 않았음을 나타낸다. DC와 YD에서 독성 Microcystis의 수가 거의 동일하였으나 MCs 농도는 DC에서 약 4배 높았으며, 이는 대청호의 독성 Microcystis의 독소 생성능이 용담호에 비해 높다는 것을 의미한다. 호소의 환경요인 변화에 따라 독성 Microcystis의 생장과 세포 당 독소 생성능이 차이가 나는 현상을 명확하게 규명하기 위하여 심도있는 연구가 필요할 것으로 판단된다.

감사의 말

본 연구는 환경부의 」폐자원에너지재활용 전문인력 양성사업『의 지원으로 수행되었습니다.

Conflict of Interest

The authors have no conflict of interest to report.

References
  1. Andersson A, Höglander H, Karlsson C, and Huseby S. 2015. Key role of phosphorus and nitrogen in regulating cyanobacterial community composition in the northern Baltic Sea. Estuar. Coast. Shelf Sci. 164, 161-171.
    CrossRef
  2. Berg M and Sutula M. 2015. Factors affecting the growth of cyanobacteria with special emphasis on the Sacramento-San Joaquin Delta. Southern California Coastal Water Research Project Technical Report 869 August 2015.
  3. Bouaïcha N, Miles CO, Beach DG, Labidi Z, Djabri A, Benayache NY, and Nguyen-Quang T. 2019. Structural diversity, characterization and toxicology of microcystins. Toxins 11, 714.
    Pubmed KoreaMed CrossRef
  4. Cho YC, Kang CS, and Kim SJ. 1993. Variations of microbial populations and phosphorus concentration at the red tide area in Lake Soyang. Korean J. Microbiol. 31, 458-464.
  5. Degerholm J, Gundersen K, Bergman B, and Söderbäck E. 2006. Phosphorus-limited growth dynamics in two Baltic Sea cyanobacteria, Nodularia sp. and Aphanizomenon sp. FEMS Microbiol. Ecol. 58, 323-332.
    Pubmed CrossRef
  6. Downing TG, Meyer C, Gehringer MM, and van de Venter M. 2005. Microcystin content of Microcystis aeruginosa is modulated by nitrogen uptake rate relative to specific growth rate or carbon fixation rate. Environ. Toxicol. 20, 257-262.
    Pubmed CrossRef
  7. Edwin W, Kardinaal WEA, and Visser PM. 2005. Dynamics of cyanobacterial toxins, pp. 41-63. In Huisman J, Matthijs HCP, and Visser PM (eds.). Harmful Cyanobacteria, Aquatic Ecology Series, vol. 3. Springer, Dordrecht, The Netherlands.
    CrossRef
  8. Giraudet H, Berthon JL, and Buisson B. 1997. A comparison of the daily alkaline phosphatase activity of a cyanobacterium (Microcystis aeruginosa) and a diatom (Synedra capitata). C. R. Acad. Sci. III 320, 451-458.
  9. Huisman J, Codd GA, Paerl HW, Ibelings BW, Verspagen JM, and Visser PM. 2018. Cyanobacterial blooms. Nat. Rev. Microbiol. 16, 471-483.
    Pubmed CrossRef
  10. Ibelings BW, Kurmayer R, Azevedo SM, Wood SA, Chorus I, and Welker M. 2021. Understanding the occurrence of cyanobacteria and cyanotoxins, pp. 213-294. In Chorus I and Welker M (eds.). Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences, Monitoring and Management, CRC Press, Boca Raton, Florida, USA.
    CrossRef
  11. Izydorczyk K, Carpentier C, Mrówczyński J, Wagenvoort A, Jurczak T, and Tarczyńska M. 2009. Establishment of an alert level framework for cyanobacteria in drinking water resources by using the algae online analyser for monitoring cyanobacterial chlorophyll a. Water Res. 43, 989-996.
    Pubmed CrossRef
  12. Jeon YH, Kim DH, Oh KH, and Cho YC. 2022. Status and causes of cyanobacterial blooming in the downstream of Jecheon Stream. Korean J. Ecol. Environ. 55, 111-119.
    CrossRef
  13. Joo JH, Park BS, Kim SH, and Han MS. 2020. Superiority comparison of biologically derived algicidal substances (naphthoquinone derivative) with other optional agents using microcosm experiments. Korean J. Environ. Biol. 38, 114-126.
    CrossRef
  14. Jung WS, Jo BG, Kim YD, and Kim SE. 2019. A study on the characteristics of cyanobacteria in the mainstream of Nakdong River using decision trees. J. Wet. Res. 21, 312-320.
  15. Kim J, Chae M, Yoon J, and Seok K. 2021. Water quality similarity evaluation in Geum River using water quality monitoring network data. J. Environ. Impact Assess. 30, 75-88.
  16. Kolzau S, Wiedner C, Rücker J, Köhler J, Köhler A, and Dolman AM. 2014. Seasonal patterns of nitrogen and phosphorus limitation in four German lakes and the predictability of limitation status from ambient nutrient concentrations. PLoS ONE 9, e96065.
    Pubmed KoreaMed CrossRef
  17. Kozak A, Celewicz-Gołdyn S, and Kuczyńska-Kippen N. 2019. Cyanobacteria in small water bodies: the effect of habitat and catchment area conditions. Sci. Total Environ. 646, 1578-1587.
    Pubmed CrossRef
  18. Lee I, Kim J, Ahn JM, and Yang DS. 2018. Simultaneous determination of seven cyanobacterial toxins in river water by liquid chromatography-tandem mass spectrometry. J. Environ. Anal. Health Toxicol. 21, 78-86.
  19. Li H, Gu X, Chen H, Mao Z, Shen R, Zeng Q, and Ge Y. 2022. Co-occurrence of multiple cyanotoxins and taste-and-odor compounds in the large eutrophic Lake Taihu, China: dynamics, driving factors, and challenges for risk assessment. Environ. Pollut. 294, 118594.
    Pubmed CrossRef
  20. Liu J, Chen L, and Zhang X. 2022. Current research scenario for biological effect of exogenous factors on microcystin synthesis. Environ. Sci. Pollut. Res. 29, 26190-26201.
    Pubmed CrossRef
  21. Long BM, Jones GJ, and Orr PT. 2001. Cellular microcystin content in N-limited Microcystis aeruginosa can be predicted from growth rate. Appl. Environ. Microbiol. 67, 278-283.
    Pubmed KoreaMed CrossRef
  22. Ma J, Wang P, Ren L, Wang X, and Paerl HW. 2019. Using alkaline phosphatase activity as a supplemental index to optimize predicting algal blooms in phosphorus-deficient lakes: a case study of Lake Taihu, China. Ecol. Indic. 103, 698-712.
    CrossRef
  23. Massey IY and Yang F. 2020. A mini review on microcystins and bacterial degradation. Toxins 12, 268.
    Pubmed KoreaMed CrossRef
  24. McQuaid N, Zamyadi A, Prévost M, Bird DF, and Dorner S. 2011. Use of in vivo phycocyanin fluorescence to monitor potential microcystin-producing cyanobacterial biovolume in a drinking water source. J. Environ. Monitor. 13, 455-463.
    Pubmed CrossRef
  25. MOE, Ministry of Environment. 2017. Investigation of bioaccumulation of cyanotoxin in freshwater environments (II). Ministry of Environment, Sejong, Korea. https://library.me.go.kr/#/search/detail/5633385#btn-export.
  26. MOE, Ministry of Environment. 2016. Standard methods for analysis of water pollution. Ministry of Environment, Korea, Sejong, Korea. https://law.go.kr/admRulSc.do?menuId=5&subMenuId=43&tabMenuId=193&query=%EC%88%98%EC%A7%88%EC%98%A4%EC%97%BC#liBgcolor38.
  27. Mustapha S, Tijani JO, Ndamitso MM, Abdulkareem AS, Shuaib DT, and Mohammed AK. 2021. A critical review on geosmin and 2-methylisoborneol in water: Sources, effects, detection, and removal techniques. Environ. Monit. Assess. 193, 204.
    Pubmed CrossRef
  28. Oh KH. 2009. Ph.D. thesis. Screening of conserved DNA sequences in microcystin-producing cyanobacteria and application of the sequences to monitor microcystins in water reservoirs. Seoul National University, Seoul, Republic of Korea.
  29. Oh KH, Jeong DH, and Cho YC. 2013. Quantification of toxigenic Microcystis spp. in freshwaters by quantitative real-time PCR based on the microcystin synthetase A gene. J. Microbiol. 51, 18-24.
    Pubmed CrossRef
  30. Oh KH, Jeong DH, Shin SH, and Cho YC. 2012. Simultaneous quantification of cyanobacteria and Microcystis spp. using real-time PCR. J. Microbiol. Biotechnol. 22, 248-255.
    Pubmed CrossRef
  31. Olson CR and Jones SE. 2022. Chlorophyll-total phosphorus relationships emerge from multiscale interactions from algae to catchments. Limnol. Oceanogr. Lett. 7, 483-491.
    CrossRef
  32. Padisák J, Chorus I, Welker M, Maršálek B, and Kurmayer R. 2021. Laboratory analyses of cyanobacteria and water chemistry, pp. 689-743. In Chorus I and Welker M (eds.). Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences, Monitoring and Management, CRC Press, Boca Raton, Florida, USA.
    CrossRef
  33. Paerl HW, Xu H, McCarthy MJ, Zhu G, Qin B, Li Y, and Gardner WS. 2011. Controlling harmful cyanobacterial blooms in a hyper-eutrophic lake (Lake Taihu, China): the need for a dual nutrient (N & P) management strategy. Water Res. 45, 1973-1983.
    Pubmed CrossRef
  34. Park HK, Kim H, Lee JJ, Lee JA, Lee H, Park JH, Seo J, Youn SJ, and Moon J. 2011. Investigation of criterion on harmful algae alert system using correlation between cell numbers and cellular microcystins content of Korean toxic cyanobacteria. J. Korean Soc. Water Environ. 27, 491-498.
  35. Plaas HE and Paerl HW. 2021. Toxic cyanobacteria: a growing threat to water and air quality. Environ. Sci. Technol. 55, 44-64.
    Pubmed CrossRef
  36. Rinta-Kanto JM, Konopko EA, DeBruyn JM, Bourbonniere RA, Boyer GL, and Wilhelm SW. 2009. Lake Erie Microcystis: Relationship between microcystin production, dynamics of genotypes and environmental parameters in a large lake. Harmful Algae 8, 665-673.
    CrossRef
  37. Saleh N, Al-Jassabi S, Eid AH, and Nau WM. 2021. Cucurbituril ameliorates liver damage induced by Microcystis aeruginosa in a mouse model. Front. Chem. 9, 660927.
    Pubmed KoreaMed CrossRef
  38. Saxton MA, Arnold RJ, Bourbonniere RA, McKay RML, and Wilhelm SW. 2012. Plasticity of total and intracellular phosphorus quotas in Microcystis aeruginosa cultures and Lake Erie algal assemblages. Front. Microbiol. 3, 3.
    Pubmed KoreaMed CrossRef
  39. Schirrmeister BE, Dalquen DA, Anisimova M, and Bagheri HC. 2012. Gene copy number variation and its significance in cyanobacterial phylogeny. BMC Microbiol. 12, 177.
    Pubmed KoreaMed CrossRef
  40. Shi K, Zhang Y, Zhang Y, Qin B, and Zhu G. 2020. Understanding the long-term trend of particulate phosphorus in a cyanobacteria-dominated lake using MODIS-Aqua observations. Sci. Total Environ. 737, 139736.
    Pubmed CrossRef
  41. Son M, Chung HS, Park CH, Park J, Lim C, and Kim K. 2018. The change of phytoplankton community structure and water quality in the Juksan Weir of the Yeongsan River watershed. Korean J. Environ. Biol. 36, 591-600.
    CrossRef
  42. Stow CA and Cha Y. 2013. Are chlorophyll a-total phosphorus correlations useful for inference and prediction?. Environ. Sci. Technol. 47, 3768-3773.
    Pubmed CrossRef
  43. Susini V, Rossi VL, Sanesi A, and Drazek L. 2018. Kinetics study on recombinant alkaline phosphatase and correlation with the generated fluorescent signal. J. Immunoassay Immunochem. 39, 108-118.
    Pubmed CrossRef
  44. Swe T, Miles CO, Cerasino L, Mjelde M, Kleiven S, and Ballot A. 2021. Microcystis, Raphidiopsis raciborskii and Dolichospermum smithii, toxin producing and non-toxigenic cyanobacteria in Yezin Dam, Myanmar. Limnologica 90, 125901.
    CrossRef
  45. Vaitomaa J, Rantala A, Halinen K, Rouhiainen L, Tallberg P, Mokelke L, and Sivonen K. 2003. Quantitative real-time PCR for determination of microcystin synthetase e copy numbers for Microcystis and Anabaena in lakes. Appl. Environ. Microbiol. 69, 7289-7297.
    Pubmed KoreaMed CrossRef
  46. Vollenweider R and Kerekes J. 1982. Eutrophication of waters. Monitoring, assessment and control. OECD Cooperative programme on monitoring of inland waters. OECD, Paris, France.
  47. Vrba J, Macholdová M, Nedbalová L, Nedoma J, and Šorf M. 2018. An experimental insight into extracellular phosphatases-differential induction of cell-specific activity in green algae cultured under various phosphorus conditions. Front. Microbiol. 9, 271.
    Pubmed KoreaMed CrossRef
  48. Vu HP, Nguyen LN, Zdarta J, Nga TT, and Nghiem LD. 2020. Blue-green algae in surface water: problems and opportunities. Curr. Polluti. Rep. 6, 105-122.
    CrossRef
  49. Wang C, Yang Y, Yang B, Lin H, Miller TR, Newton RJ, and Guo L. 2021. Causal relationship between alkaline phosphatase activities and phosphorus dynamics in a eutrophic coastal lagoon in Lake Michigan. Sci. Total Environ. 787, 147681.
    CrossRef
  50. Wei S, Zhuang G, Cheng L, and Wang S. 2022. The proliferation rule of Microcystis aeruginosa under different initial pH conditions and its influence on the pH value of the environment. Environ. Sci. Pollut. Res. Int. 29, 13835-13844.
    Pubmed CrossRef
  51. Yang J, Tang H, Zhang X, Zhu X, Huang Y, and Yang Z. 2018. High temperature and pH favor Microcystis aeruginosa to outcompete Scenedesmus obliquus. Environ. Sci. Pollut. Res. Int. 25, 4794-4802.
    Pubmed CrossRef
  52. Zhou J, Han X, Qin B, and Zhu G. 2021. Responses of alkaline phosphatase activity to wind-driven waves in a large, shallow lake: implications for phosphorus availability and algal blooms. J. Environ. Sci. 99, 143-150.
    Pubmed CrossRef


December 2023, 59 (4)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information

Funding Information