search for




 

Anti-obesity and anti-diabetic effects of fermented Momordicae charantiae fructus with Lactobacillus plantarum CBT-LP3
Korean J. Microbiol. 2024;60(1):12-25
Published online March 31, 2024
© 2024 The Microbiological Society of Korea.

Sang Hee Kwak , Byung Chull An , Jun Young Ahn , Jusung Lee , Myung Jun Chung , and Yongku Ryu*

R&D Center, Cell Biotech, Co., Ltd, Gimpo 10003, Republic of Korea
Correspondence to: *E-mail: ykryu@cellbiotech.com;
Tel.: +82-31-987-8101; Fax: +82-31-987-8109
Received January 11, 2024; Revised February 27, 2024; Accepted February 28, 2024.
Abstract
As the prevalence of diabetes in South Korea continues to rise, there is a rapid increase in the prescription rate of oral hypoglycemic agents. Given that these medications need to be taken for a lifetime, there is a necessity to develop treatments that ensure long term safety and devoid of any side effects. Although much research has been conducted on the development of alternative drugs using plant-derived extracts, the active ingredients obtained through general extraction methods have limited effectiveness. Therefore, it is necessary to develop materials that maximize efficacy. Traditionally, Momordicae charantiae (MC) has been known for its effective anti-diabetic properties, so we utilized our own lactic acid bacteria, L. plantarum CBT-LP3, to enhance the anti-diabetic efficacy of MC. In the present study, we assessed the anti-diabetic and anti-obesity activities of bio-fermented M. charantiae fructus (BMC) using in vitro exams. The results demonstrated that the BMC increased glucose uptake through Glut4 induction in 3T3-L1 adipocytes. The BMC also effectively decreased lipid accumulation compared to untreated adipocytes. Furthermore, we found that the BMC substantially induced fat browning compared to untreated adipocytes. BMC, as another property, significantly increased reviving and recovering partially destroyed β cells by streptozotocin (STZ) treatment. This result suggests that BMC can protect and help to recover β cells against damage. In addition, BMC improved β cell dysfunction in high glucose conditions and protected against oxidative stress-induced diabetes. In conclusion, this study demonstrated that the fermentation of M. charantiae fructus using CBT-LP3 enhanced its anti-diabetic and anti-obesity effects.
Keywords : Lactobacillus plantarum, M. charantiae fructus, anti-diabetic, anti-obesity, INS-1 pancreatic beta cell, 3T3-L1 adipocytes
Body

당뇨병(Diabetes mellitus, DM)은 포도당 대사 이상으로 인하여 발생하는 질환이다(Hue et al., 2009). 일반적으로 당뇨병은 그 병인론적 특성에 근거하여 두 가지로 분류되는데, 자가면역 기전에 의해 췌장의 베타세포가 파괴되어 이에 따른 체내 인슐린 부족으로 유발된 인슐린 의존형 당뇨병인 제 1형 당뇨병(Insulin-dependent DM, IDDM. Type 1)과 비만 등으로 인해 인슐린 수용체에 이상이 나타나서 인슐린 저항성 같은 신호전달의 문제로 파생된 인슐린 비 의존형 당뇨병인 제 2형 당뇨병(Non-insulin-dependent DM, NIDDM. Type 2)이다(Atkinson and Maclaren, 1994; DeFronzo, 2004; Tan et al., 2019). 대한당뇨병학회가 최근 발표한 Diabetes Fact Sheet in Korea (DFS)에 따르면 2020년 현재 우리나라 30세 이상 당뇨병 환자는 약 600만 명으로, 2012년 Diabetes Fact Sheet를 통해 2050년에 도달할 것으로 예측한 환자수(591만명)를 30년 앞서 추월했다(Bae et al., 2022; Korean Diabetes Association, 2022). 그러나 당뇨병의 치료와 관련된 경구 투여 약물들은 부작용들이 보고되고 있어(Lee, 2008) 인체 내 부작용을 줄이고 항당뇨 효과를 가지는 천연물 치료제 개발에 대한 많은 연구가 절실히 필요하다(Salimifar et al., 2013; Li et al., 2019). 당뇨병 예방을 위한 이러한 시대적 요구는 천연물에 대한 기대로 이어져 천연소재의 항당뇨 기전에 대한 연구가 증가하고 있으며, 부작용을 최소화하고 인슐린 저항성을 개선시킬 수 있는 천연물 소재 개발에 대한 연구에 집중되고 있다.

여주는 박과(Cucurbitaceae)에 속하는 열대 아시아산 한해살이 덩굴성 식물로 쓴맛을 가지고 있어 고과 또는 Bitter melon이라고 불린다(Moon et al., 2015; Jia et al., 2017). 우리나라 전역에서 재배되는 여주는 스테롤 배당체, 글루코사이드, 아미노산, 사포닌, 알칼로이드, 비타민C, 탄수화물, 미네랄 및 베타카로틴 등 다양한 생리활성 물질을 다량 함유하고 있으며, 특히 과실과 종자에 주로 함유되어 있는 카란틴(charantin)은 췌장 베타세포에 작용하여 인슐린의 분비를 촉진함으로써 혈당 강하 효과를 가지는 것으로 알려져 있다(Moon et al., 2015; Goo et al., 2016). 예로부터 여주는 차의 형태로 인도, 중국, 아프리카, 라틴아메리카 등 많은 지역에서 약재로 사용되어 왔다. 반면 우리나라에서는 남부지방 가정에서 관상용으로 한두 개 심는 것이 전부였는데, 최근 국내에도 여주의 여러 생리적 효능이 알려지면서 혈당 강하를 위한 음료와 차 등으로 사용되고 있다(Lee et al., 2012). 하지만 여주가 민간에서 널리 사용되고 있는 상황에 비해 여주의 이용 및 효능에 관한 과학적 분석 연구 등은 아직 미미한 실정이다.

최근에 여러 기능성 화학물질을 가진 식물 유래 추출물을 이용한 건강 기능성식품 개발에 관한 많은 연구가 이루어지고 있으나 일반적인 추출 방법에 의해 수득된 성분은 그 효과가 미미한 한계점을 나타내어 효능을 극대화한 소재의 개발이 요구되고 있다. 미생물을 이용한 발효(Bio-fermentation)는 가장 오래된 역사를 가진 생물학의 기술로 산업 전반에 걸친 기술개발이 현재에도 이루어 지고 있으며, 특히 식품에서의 기술개발이 주류를 이루고 있다(Seok et al., 2010; Kim et al., 2013). 식물 추출물 발효식품은 건강식품에 속하는 제품 유형으로 식품공전(Korea Food and Drug Administration, 2000)에 등재되어 있으며, 일반적으로는 여러가지 식물성 원료에 당을 첨가하거나 유산균 등의 미생물을 첨가하여 일정 기간 발효시켜 제조한다(Kim and Lee, 2003; Seo et al., 2020). 특히, LactobacillusBifidobacterium과 같은 유산균은 당류를 발효를 통해 유산, 즉 젖산을 생성하는 세균으로 다양한 미생물이 존재하는 사람의 장내에서 우세균으로 분포하고 체내의 유익균의 성장을 촉진하는 생균 활성제(probiotics)로서 위장기능 개선, 체내 콜레스테롤 흡수 저해, 면역 증강 작용, 영양소의 흡수 및 이용률을 높이는 등 다양한 질병 예방 효과와 생리조절 작용을 하는 것으로 밝혀져 주목받는 건강기능성 식품 소재이다(Fuller, 1989; Goldin, 1998; Jung, 2001). 이에 본 논문에서는 여주의 항당뇨 효능 증진을 위해 자사 특허 유산균 Lactobacillus plantarum CBT-LP3 (기탁번호: KCTC 10782BP)을 이용하였으며, 발효 전과 후의 항당뇨 및 항비만 활성을 in vitro 실험을 통해 평가하여 그 효능과 분자적 기전을 보고하고자 한다.

재료 및 방법

추출물의 제조

여주는 제주에서 재배된 제주오가닉스 유기농 여주 열매분말을 구매하여 사용하였다. 건조 여주분말과 증류수를 10% (w/v, 0.1 g/ml)의 비율로 혼합하여 고압멸균기를 통해 121°C, 15분간 반응시켜 오염균 제거한 후 저온 실험실(Cold room)에서 하루 냉각시켰다. 수산화나트륨을 이용하여 pH7로 보정한 후 LP3를 3 × 104 CFU/ml로 접종하였고, 30°C 조건에서 150 rpm, 96시간 발효를 수행하였다. 이 혼합물을 12,000 rpm, 4°C, 20분 동안 원심분리 후 상등액을 확보하여 여주 유산균 발효체(Biofermented momordica charantia L. extracts, BMC)을 제조하였다. 대조군인 여주 침지물(Momordica charantia L. extracts, MC)은 유산균을 첨가하지 않고 동일한 방법으로 제조하였다(Fig. 1).

Fig. 1. Manufacturing process.

3T3-L1 세포 배양 및 지방 분화

섬유아세포인 3T3-L1 세포는 American Type Culture Collection (CL-173, ATCC)에서 구입하였다. 3T3-L1 세포의 생육배지로 1X penicilin/streptomycin/glutamine (P/S/G, Gibco)과 10% bovine calf serum (BCS, HyClone)가 포함된 Dulbecco’s modified Eagles medium (DMEM, Gibco)을 사용하였고 37°C, 5% CO2 배양기에서 배양하였다. 3T3-L1을 지방구 세포로 유도하는 방법은 Tamar Golan 등의 방법에 따라 실시하였다(Golan et al., 2019). 방법을 간략히 기술하면(Fig. 2), 6 well plate에 세포를 분주하여 high-glucose DMEM에 10% FBS, 1% penicillin-streptomycin을 공급하여 37°C, 5% CO2 배양 조건 하에서 세포가 85% 될 때까지 배양하였다. 이때 1.5 μg/ml insulin, 500 μM IBMX 및 1 μM dexamethasone (MDI)을 포함하는 3T3-L1 differentiation kit (DIF001; Sigma-Aldrich)를 10% Fetal bovine serum (FBS, Atlasbio)가 포함된 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12, Gibco) 배지에 첨가하여 세포에 처리하였다. 처리 2일 후 10% FBS와 1.5 μg/ml insulin (Sigma-Aldrich) 배양액으로 추가 배양을 실시하였으며, 매 2일 배지를 교체해주며 분화 유도 물질을 세포에 공급한지 8일 후 섬유아세포의 형태를 지니던 3T3-L1이 구형 모양의 지방세포로 분화된 것을 확인하고 실험에 사용하였다.

Fig. 2. Experimental scheme. For the induction of adipocyte differentiation, 3T3-L1 preadipocytes were seeded. At confluence (day 0), the cultured preadipocytes were induced to differentiate by the addition of differentiating medium containing 115 μg/ml methylisobutylxanthine (IBMX), 10 μg/ml insulin, and 1 μM dexamethasone (Dex) from day 0 to day 2. At day 2, medium was changed with medium containing 10 μg/ml insulin for an additional 4 days from day 2 to day 6. The medium was refreshed every 2 days. At day 6, differentiated 3T3-L1 cells were incubated with MC or BMC or 1 µM insulin for 15 minutes and then assayed for glucose uptake activities (a). Mature adipocytes were used for Real-time PCR analysis. MC or BMC were added to the cell culture medium at concentration of 2% from day 0 to day 2 (b). DMEM, Dulbecco’s modified Eagle’s medium. DMEM/F12, Dulbecco’s modified Eagle medium/Nutrient Mixture F-12.

INS-1 세포 배양

쥐의 인슐린종 세포주인 INS-1 세포는 계대 번호가 20에서 30번 사이의 것을 사용하였고, Roswell Park Memorial Institute 1640 Medium (RPMI 1640, Gibco) 배지에 10% FBS, 1% penicillin-streptomycin을 혼합하여 37°C, 5% CO2 배양기에서 배양하였다. 배양액은 3~4 일 간격으로 교대하였고, trypsin-EDTA (Invitrogen Co.)로 계대배양 하였다.

세포독성 측정

INS-1 췌장베타세포를 96 well plate에 5 × 104 cells/well로 과종하고 이후, MC와 BMC를 각 2% 농도로 처리하고 48시간 동안 배양하였다. 처리 시간 이후, cell counting kit-8 용액(CCK-8, Dojindo Molecular Technologies)을 각 well에 10 μl씩 추가하고 1시간 반응시킨 뒤, 형성된 formazan을 용해하여 흡광도를 측정하였다. 그리고 각 시료를 처리하지 않은 대조군과 비교하여 세포의 생존능을 비교하였다(Lee and Kwon, 2020).

세포 생존률(%) = 시료의 흡광도/대조군의 흡광도 × 100

포도당 흡수능 측정

96 well plate에 과종된 3T3-L1 세포의 분화가 완료되면 포도당이 없는 배지로 교체하여 16시간 배양 후, 2% BSA가 포함된 100 μl Krebs-Ringer phosphate buffer [in mM: 137 NaCl, 4.7 KCl, 10 sodium phosphate (pH 7.4), 0.5 MgCl2, 1 CaCl2]로 40분간 배양하여 세포 내 잔여 영양분을 고갈시켰다. MC 또는 BMC와 함께 1 mM 2-deoxyglucose (2-DG)를 처리하여 15분간 배양하여 샘플을 준비하였다(Fakhoury et al., 2018). Glucose uptake assay kit (Promega)을 이용하여 측정하였다(Wang et al., 2017).

현미경 관찰을 통한 지방축적 억제활성 평가

분화가 완료된 3T3-L1 지방세포 내 지방구의 수와 크기는 현미경 관찰을 통해 정성분석 하였다. 현미경 사진은 각 10X, 20X 배율로 촬영하였다.

Oil red O 염색

분화과정에 따른 3T3-L1 세포 내 지방 축적량을 확인하기 위하여 MDI 처리기간 동안 각 시료를 2% 농도로 48시간 처리한 6 well plate에서 8일 동안 분화된 3T3-L1 세포의 배양액을 제거한 후, 10% formalin 1 ml를 첨가하여 5분간 실온에서 방치하였다. 이후 동량의 10% formalin 용액을 다시 첨가하고 분화된 세포를 1시간 이상 실온에서 방치한 후 상등액을 제거하고 60% isopropanol 500 µl를 첨가하여 세포를 세척한 후 완전히 건조시켰다. Oil red O working solution (Oil red O:멸균증류수 = 6:4)으로 세포 내에 축적된 지방성분들을 염색한 후 PBS (phosphate buffered saline, pH 7.4)를 사용하여 3~5회 이상 세척한 후 염색된 세포는 현미경으로 관찰하였다(Kwak and Kim, 2018; Yoon and Pyo, 2022).

Real-Time PCR

분화 완료된 세포를 회수 후 RNeasy Mini Kit (Qiagen)를 이용하여 RNA 추출하였다. NanoDrop (molecular devices) 기기를 이용하여 추출된 RNA 농도 확인한 후 정량하였다. TOPscript RT DryMIX dN6 plus (enzynomics)를 이용하여 cDNA 합성(합성 조건: 25°C 10분, 42°C 1시간, 95°C 5분, 4°C)한 후, TB Green Premix Ex Taq II (Takara Bio)를 이용하여 qRT-PCR (BIO-RAD) 진행하였다(qRT-PCR 조건: 50°C 5분, 95°C 15분, 95°C 15초, 60°C 30초, 72°C 30초 40 cycle). 확인된 CT 값을 이용하여 ΔΔCT 값 산출 후 유전자 발현변화를 분석하였다(Table 1).

Primer-probe sets for real-time PCR

Gene name Forward Reverse
Fgf21 ACACAATTCCAGCTGCCTTG TAGAGGCTTTGACACCCAGG
Pparγ CGC TGA TGC ACT GCC TAT GA AGA GGT CCA CAG AGC TGA TTC C
Cebpα AAA CAA CGC AAC GTG GAG A GCG GTC ATT GTC ACT GGT C
Glut4 CCAACAGCTCTCAGGCATCA TGACCACACCAGCTCCTATGG
Wdnm1 CCTGGGCTCTGTCTAACC CATCGTTCATCACAAGTTCC
Pgc1α CCCTGCCATTGTTAAGACC TGCTGCTGTTCCTGTTTTC
Ucp-1 GATGGTGAACCCGACAACTT CTGAAACTCCGGCTGAGAAG
Prdm16 GAAGGTGTCCAAACTGACAATGC CGTCACTTTTGGCTAGCTTCCT
Cidea CCAGAGTCACCTTCGACCTATACA CTCGTACATCGTGGCTTTGACA
β-Actin GACTTCGAGC AAGAGATGGC CCAGACAGCA CTGTGTTGGC


활성산소종(reactive oxygen species, ROS) 생성량 측정

세포 내 ROS 소거활성 평가를 위하여 CellROX® Oxidative Stress Reagents (Lifetech)를 사용하여 형광을 측정하는 방법을 이용하였다. 형광 측정용 96 well plate에 INS-1 세포를 well당 4000 cell 접종하고 24시간 배양하였다. 이 후 아래 실험에서 phenol red가 없는 RPMI1640 (Gibco)에 FBS를 10% 추가한 배지를 사용하였다. 1회 PBS wash 후 모든 실험군에 1,1-Dimethylethyl hydroperoxide 1.2 mM과 각각의 샘플을 37°C에서 2시간 병행 처리하였고, 1,1-Dimethylethyl hydroperoxide 1.2 mM 2시간 단독 처리군을 비처리군으로 하였다. 샘플은 L-Ascorbic acid 10 mM, MC 또는 BMC를 각 2%씩 처리하였다. 그 후 배지를 제거하지 않고 ROS probe를 5 μM를 분주하고 37°C에서 30분 반응시키고, PBS를 이용하여 3번 wash하고, 배양 배지를 분주한 뒤 fluorescence microplate reader (Promega) 기기를 통하여 ROS의 변화량을 측정하였다(Excitation, 627 nm Emission, 660–720 nm).

Streptozotocin에 의한 세포손상에 대한 세포 회복능 측정

INS-1 췌장베타세포를 well당 10000 cell 접종하고 24시간 배양하였다. 1% FBS가 포함된 RPMI1640배지에 12.5 mM Strepozotocin (STZ)를 처리하여 대조군을 제외한 모든 군에 분주 후 6시간 동안 배양하였다. 1회 PBS wash 후 각 실험군에 증류수, MC 또는 BMC를 각 2%씩 처리한 후 48시간 배양하였다. 처리 시간 이후, WST-8 용액을 각 well에 추가하고 1시간 반응시킨 뒤, 형성된 formazan을 용해하여 흡광도를 측정하였다. 그리고 각 시료를 처리하지 않은 대조군와 비교하여 세포의 생존능을 비교하였다.

세포 생존률(%) = 시료의 흡광도/대조군의 흡광도 × 100

인슐린 분비능 측정

INS-1 췌장베타세포를 well당 1 × 105 cells/200 µl 접종하고 24시간 배양하였다. 1% FBS가 포함된 RPMI1640 배지에 MC와 BMC를 각 2% 처리한 후 48시간 배양하였다. 3회 PBS wash 후 Krebs-Ringer phosphate buffer [in mM: 137 NaCl, 4.7 KCl, 10 sodium phosphate (pH 7.4), 0.5 MgCl2, 1 CaCl2]로 12시간 세포를 굶겼다. 인슐린 분비를 자극하기 위해 2.8 mM, 5.5 mM 또는 30 mM 포도당을 포함하는 KRPB를 세포에 처리해주었다. 2시간 후 세포상층액을 수거하여 인슐린 농도 측정에 사용하였다. 인슐린 분비는 Insulin Human ELISA kit (Abcam)을 사용하여 반응시킨 후 micro plate reader (BIO-RAD)로 450 nm에서 흡광도를 측정하였다.

γ-Aminobutyric acid 함량 분석

표준 물질로 사용한 γ-aminobutyric acid (GABA)은 Sigma-Aldrich에서 구입하였다. 시료의 유도체화에 사용된 Borate buffer (PN 5061-3338), FMOC Reagent (PN 5061-3337), OPA Regent (PN 5061-3335)는 Agilent Technologies에서 구입하였다. γ-Aminobutyric acid 함량 분석은 분석은 UV-detector가 부착된 HPLC (Infinity 1290, Agilent Technologies)를 사용하였고, column은 ZORBAX Eclipse AAA (4.6 × 150 mm, 3.5 µm, Agilent Technologies)와 ZORBAX Eclipse AAA (4.6 × 12.5 mm, 5 µm, Agilent Technologies)를 결합하여 사용하였다(Fig. 3). Column oven 온도는 40°C, injection volume은 10 μl, UV wavelength는 338 nm, reference 390 nm로 수행하였다. 이동상 A는 40 mM sodium phosphate (NaH2PO4) 용액을 10N sodium hydroxide (NaOH) 용액으로 pH 7.8로 보정하여 제조하였고, 이동상 B는 acetonitrile:methanol:water를 45:45:10 (v/v) 비율로 혼합하여 제조하였다. 이동상은 2 ml/min 유속으로 농도 구배를 주어 분석하였으며, 비율은 0% (0분), 0% (1.9분), 57% (18.1분), 100% (18.6분), 100% (22.3분), 0% (23.2분), 0% (26분)로 수행하였다(Table 2).

Injection program

Function Parameter
Draw Draw 2.5 μl from location “P1-A-1” (borate buffer) with default speed using default offset
Draw Draw 0.5 μl from sample with default speed using default
Mix Mix 3 μl from air with maximum speed for 2 times
Wait Wait 0.5 min
Draw Draw 0 μl from location “P1-A-2” (water without vial cap) with default speed using default offset
Draw Draw 0.5 μl from location “P1-A-3” (OPA) with default speed using default offset
Mix Mix 3.5 μl from air with maximum speed for 6 times
Draw Draw 0 μl from location “P1-A-2” with default speed using default offset
Draw Draw 0.5 μl from location “P1-A-4” (FMOC) with default speed using default offset
Mix Mix 4 μl from air with maximum speed for 6 times
Draw Draw default volume from location “P1-A-5” (water) with default speed using default offset
Mix Mix 18 μl from air with maximum speed for 2 times
Injection Inject
Wait Wait 0.1 min
Valve Switch valve to “Bypass”


Fig. 3. Position of reagent vials.

통계 처리

통계분석 모든 자료의 통계 분석은 GraphPad Prism®8 (Graphpad Software Inc) 프로그램을 이용하여 3회 이상 측정한 평균(mean)과 표준편차(S.D.)를 나타내었다. 각 실험 군 간의 유의성 검증을 위하여 일원 배치 분산 분석(one-way ANOVA)으로 분석하였으며 Tukey’s post hoc test로 분석하여, 유의수준 p-value < 0.05인 경우 유의성이 있는 것으로 평가하였다.

결 과

포도당 흡수 촉진 효과

3T3-L1 지방세포에 여주침지물(Momordica charantia L. extracts, MC) 또는 여주 유산균 발효체(Biofermented momordica charantia L. extracts, BMC)을 처리하여 포도당 흡수능을 측정한 결과는 Fig. 4A에 제시한 바와 같다. Glucose analog인 2-deoxyglucose (2DG)는 포도당과 같은 방식으로 세포 내로 유입되어 Hexokinase에 의해 인산화(phosphorylation)된다. 이렇게 축적된 2-deoxyglucose-6-phosphate (2DG6P)는 더이상 대사되지 않고 세포 내에 축적되기 때문에 세포 내로의 2DG6P의 양을 측정하여 세포의 포도당 흡수를 모니터링 하는 데 사용하였다(Pajak et al., 2020). 3T3-L1 세포에 MC를 처리하여 포도당 흡수능을 평가하였을 때 대조군과의 유의적인 효과가 없었으나, 유산균으로 발효시킨 BMC를 처리하였을 때 2DG6P가 증가한 것을 확인하였다. 특히, 인슐린에 비교하여 약 1.8배 높은 2DG6P 양을 나타내어 포도당 흡수가 증가함을 확인하였다(Fig. 4A). BMC에 의한 Glucose uptake 효과를 분자적인 수준에서 확인하기 위해 그와 관련된 단백질의 mRNA 발현을 qPCR을 통하여 분석하였다. 그 결과, BMC를 처리한 실험군에서 제2형 당뇨병의 포도당 항상성을 개선시켜주는 핵심 유전자인 Fibroblast growth factor 21 (Fgf21)의 발현을 유의적으로 증가시켰으며(Tan et al., 2023), 하위 유전자인 peroxisome proliferator activated receptor γ (Pparγ), CCAAT enhancer binding protein α (Cebpα), 그리고 glucose transport 4 (Glut4)의 발현을 증가시켜 세포 내로의 포도당 흡수를 증가하는 것을 확인할 수 있었다(Fig. 4B and C).

Fig. 4. BMC enhances glucose uptake in 3T3-L1 by activating Fgf21 signaling pathway to increase glucose transport 4. (A) The effect of MC and BMC on glucose uptake in 3T3-L1. Values are means ± SD **p < 0.01 vs. preadipocyte, ##p < 0.01 vs. MDI. (B) Effects of MC and BMC on mRNA expression of Fgf21, Pparγ, Cebpα and Glut4 in 3T3-L1 cells. Values are means ± SD *p < 0.05, **p < 0.01 ****p < 0.0001 vs. preadipocyte, ##p < 0.01, ###p < 0.001, ####p < 0.0001 vs. MDI. (C) Graphical abstract.

지방축적 억제 효과

분화가 완료된 3T3-L1 지방세포 내 지방구의 수와 크기는 현미경 관찰을 통해 정성분석 하였다. Figure 5의 현미경 관찰 결과 분화시키지 않은 3T3-L1 전지방세포는 지방구(Lipid droplet)가 관찰되지 않았으며, 아무것도 처리하지 않고 분화를 유도한 대조군은 많은 수의 지방구가 형성된 것을 관찰하였다. Oil red O 염색 후 대조군과 비교하였을 때 MC, BMC군에서 지방형성이 억제되는 경향성을 보였으며, BMC군에서 더 많은 지방구 수 감소가 관측된다. 뿐만 아니라 염색 전 현미경 관찰한 결과, BMC군에서 지방구의 크기가 작아지는 것을 확인할 수 있었다(Fig. 5).

Fig. 5. BMC reduced lipid accumulation 3T3-L1 and induced brown fat phenotype morphology in vitro. Oil red O (ORO) staining used to assess the degree of differentiation. Microscopy observation of number and size of intracellular lipid droplets in 3T3-L1 adipocytes.

백색지방의 갈색지방화(Fat browning)

지방구 크기의 감소는 갈색지방(Brown adipocyte tissue, BAT)의 특징적 양상으로, 이를 검증하기 위해 qPCR을 통해 fat browning 관련 유전자의 발현을 살펴보았다(Stock and Cinti, 2003). Figure 6 결과, 백색 지방주(White adipocyte tissue, WAT) 3T3-L1은 지방이 분화됨에 따라 Westmead DMBA8 nonmetastatic cDNA 1 (Wdnm1)의 발현이 증가하는 것으로 보고되며, 본 논문에서도 분화유도물질 처리군에서 그 발현이 비처리군 대비 증가하는 것을 확인하였다. 분화유도 물질과 MC 또는 BMC를 처리한 군에서 그 발현이 유의적으로 감소하며, 그 발현 차이는 발효체인 BMC군에서 더 많이 감소하는 것을 확인하였다. 베이지 지방세포(Beige adipocyte) 마커인 Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Pgc1α)는 MC 또는 BMC 처리에 의해 MDI 단독처리군 보다 유의적으로 증가하였고, 백색지방의 갈색지방화에 가장 중요한 UNCOUPLING Protein (Ucp-1) 발현은 BMC군에서만 증가하는 것을 알 수 있었다. 갈색지방 세포 특이적 마커인 PR domain containing 16 (Prdm16)과 Cell death activator CIDE-A (Cidea)군 또한 BMC군에서만 유전자 발현이 유의적으로 증가하는 것을 확인하였다. 따라서, BMC는 중성지방 축적 억제와 상기와 같은 유전자의 발현량 조절을 통해 개체의 백색지방세포를 베이지색 지방세포 또는 갈색지방세포로 분화시키는 과정을 촉진하여 비만에 효과가 있을 것으로 사려되며, 이는 본 논문을 통해 처음 밝혀졌다.

Fig. 6. BMC converted 3T3-L1 adipocytes, classical white adipocytes, to brown adipocytes. Expression of white, beige and brown adipocyte selective gene markers in 3T3-L1 cells. Values are means ± SD , ***p < 0.001 ****p < 0.0001 vs. preadipocyte, #p < 0.05, ##p < 0.01, ####p < 0.0001 vs. MDI.

산화적 스트레스에 대한 췌장베타세포 보호 활성 효과

췌장 베타 세포주 INS-1 세포의 성장에 MC와 BMC가 미치는 영향을 조사하기 위해 실험을 실시하였다. 그 결과, MC와 BMC 모두 췌장베타세포의 성장성을 약 2배 가량 증가 시켰다(Fig. 7A). Streptozotocin (STZ)를 처리하여 베타 세포에 인위적으로 당뇨병을 유발시킨 뒤 세포 회복능을 살펴보았다(Qiao et al., 2021). 대조군을 제외한 모든 군에 STZ 12.5 mM로 처리하여 세포자멸사를 유도한 뒤 WST-8을 측정한 결과, 대조군 대비 STZ를 단독 처리한 군에서 세포 생존율이 약 50% 감소한 것을 확인할 수 있었으며, MC와 BMC를 처리한 군의 세포 증식은 대조군과 비슷한 수준으로 회복되는 것을 확인할 수 있었다(Fig. 7B). 췌장베타세포는 항산화 효소가 부족하여 산화 스트레스에 특히 취약하며, 베타세포의 산화 스트레스에 대한 방어력을 더욱 약화시킨다. t-butyl hydroperoxide (TBHP)를 처리하여 활성산소를 유도한 조건에서 양성대조군으로 L-ascorbic acid와 MC 또는 BMC를 처리하여 물질의 항산화 효능을 검증해본 결과, 대조군 대비 MC 또는 BMC 처리군에서 약 30% 정도 ROS 소거능 효과를 나타내었다(Fig. 7C). 이는 본 시료가 산화적 환경에서 췌장베타세포를 보호하여 항당뇨 효과를 가질 수 있다는 것을 시사한다.

Fig. 7. Prevention of Streptozotocin (STZ) or hydrogen peroxide-induced pancreatic beta cell damage by MC and BMC. (A) The effect of MC and BMC on proliferation in INS-1 cell. Values are means ± SD, ****p < 0.0001 vs. control. (B) Recovering effect of partially destroyed β cells by STZ treatment. Values are means ± SD, **p < 0.01 vs. control, ##p < 0.01, ###p < 0.001 vs. STZ. (C) Intracellular reactive oxygen species (ROS) level in INS-1 cells. Values are means ± SD , ****p < 0.0001 vs. control.

고농도 당독성에 대한 췌장베타세포 기능부전 회복 효과

당뇨 발생에 의해 췌장베타세포가 고농도의 포도당에 장기간 노출되면 베타세포의 기능 이상으로 인슐린 유전자 발현이 감소하여 인슐린 합성 및 분비가 감소하는 것으로 알려져 있다(Ola et al., 2018; Eguchi et al., 2021). 이에 본 실험에서 포도당 자극 하 MC와 BMC가 췌장베타세포의 인슐린 분비에 미치는 영향을 평가하였다. 저혈당(2.8 mM), 정상혈당(5.5 mM), 고혈당(33 mM) 조건 아래 MC와 BMC를 각 2% 농도로 2시간 처리한 결과, 대조군 대비 저혈당, 정상혈당 조건에서 두 물질 모두 인슐린 분비를 증가시키는 것을 확인할 수 있었으며, BMC의 처리에 의해 고농도 포도당에 의한 인슐린 분비 감소가 완화되는 것을 확인할 수 있었다(Fig. 8).

Fig. 8. BMC stimulated insulin secretion under hyperglycemic condition. Hypoglycemia: 2.8 mmol/L, Normal: 5.5 mmol/L, Hyperglycemia: 33 mmol/L (glucose). Values are means ± SD, *p < 0.05 **p < 0.01 vs. Control, #p < 0.05 vs. MC.

유산균 발효에 의한 γ-Aminobutyric acid의 함량 변화

여주침지물 MC의 GABA 함량은 114.3 ± 0.46 µg/ml 이고 여주 유산균 발효체 BMC는 132.4 ± 4.48 µg/ml 으로 비발효체에 비해 약 15.8% 증가하였다(Table 3). 따라서 여주 지표성분인 GABA가 LP3 유산균 발효에 의해 증가한 것으로 사료된다(Fig. 9).

Content of γ-Aminobutyric acid at 338 nm

Sample Retention time (min) GABA (µg/ml)
MC 9.320 114.3 ± 0.46
BMC 9.319 132.4 ± 4.48


Fig. 9. HPLC analysis of γ-Aminobutyric acid (GABA). Chromatogram of (A) GABA Standard (100 ppm), (B) MC and BMC.
고 찰

발효는 고대부터 사용되어 온 가공방법으로, 유익 미생물의 작용을 통해 천연물의 유용성분과 영양적 특성을 향상시킬 수 있는 장점이 있다(Hubert et al., 2008). 특히, 발효에 널리 이용되는 유산균은 인간에게 가장 유익한 미생물로 발효식품부터 의약품까지 모든 분야에 널리 활용되고 있다. 유산균의 주요 대사산물인 젖산(lactic acid)은 pH를 급격히 감소시켜 부패균의 성장을 억제하고 불용성 무기성분을 가용화하는 작용을 한다(Han, 2005). 또한 유산균 발효는 식품의 기능성을 증가시키기도 하는데, 그 예로 Jung 등의 연구에서 Lactobacillus plantarum로 발효 시킨 천년초 열매 추출물을 먹인 고지방식이 공급 마우스가 미발효 천년초 열매 추출물보다 체지방 감소에 있어 더 효과적이라는 연구결과와(Jung et al., 2017), 제 2형 당뇨모델인 db/db 마우스 모델에 유산균을 접종하여 배양시킨 부추발효물의 항당뇨 효능 실험 결과에서 부추추출물 단독처리 군 대비 포도당 내성과 인슐린 저항성이 효과적으로 개선되는 것을 확인한 바 있다(Kim et al., 2015).

제 2형 당뇨병의 경우 인슐린 저항성 발생으로 인한 고혈당이 주된 원인으로 이는 근육, 지방조직과 같은 말초조직에서 인슐린 민감성을 개선함으로써 당뇨병 및 당뇨 합병증의 증상을 호전시킬 수 있다(Kim et al., 2019). 더욱이 갈색지방은 열생성 과정에서 지방산 및 포도당을 주된 에너지원으로 사용하기 때문에 갈색지방의 활성화는 체내 포도당 대사에도 영향을 미친다(Sharma et al., 2022). 실제로 비만 및 당뇨환자에서 갈색지방의 포도당 흡수 능력이 현저히 감소되어 있음이 보고되고 있으며, 최근 연구결과 갈색지방의 크기 또는 그 활성화 정도가 인슐린 저항성과 관련이 있음이 밝혀지고 있다(Cho et al., 2006; Seo et al., 2020; Sharma et al., 2022). 본 실험 결과 BMC를 처리하였을 때 2DG6P의 양이 증가한 것을 확인했으며, 세포 내 포도당 흡수를 촉진함으로써 혈당 강하 효과를 나타낼 것으로 생각한다. 또한 간, 췌장 및 지방 조직에서 많은 수준으로 합성되는 Fgf21 유전자의 발현 증가를 중심으로, 그 하위 유전자의 발현을 조절하여 Glut4 수용체를 통한 glucose uptake의 증가 및 백색지방의 갈색지방화를 하며 중성지방의 감소 효과를 나타냈다(Badman et al., 2007; Inagaki et al., 2007; Jiang et al., 2014). Fan이 발표한 논문에 따르면, 여주는 AMPK (AMP-activated protein kinase) 활성화 기전을 통해 Pparγ, Cebpα와 같은 하위 유전자의 조절함으로써 세포질에서 세포막으로 Glut4 수송을 촉진하여 포도당 흡수를 증가시키거나 지방산 산화를 증가시킴으로써 항비만, 항당뇨 효능을 나타내는 것으로 보고된다(Fan et al., 2019). Fgf21은 AMPK의 상위 활성 인자로 Fibroblast growth factor의 한 종류로서 발현 조직에 따라 endo/paracrine 특징을 보여주며, 포도당 대사 및 에너지 항상성을 포함하는 많은 종류의 대사 경로를 조절하고 있다(Jimenez et al., 2018; Song, 2020). Xu 와 Ding 의 연구결과에 따르면 Fgf21은 ob/ob 마우스의 백색 및 갈색 지방세포에 작용하여 포도당 흡수의 가장 중요한 구성 성분인 Glut4, Glut1의 발현과 포도당 인산화 효소 Hexokinase의 발현을 증가시킴으로써 장기적인 고혈당증 호전 효과를 가지는 것으로 보고된다(Ding et al., 2012; BonDurant et al., 2017; Xu et al., 2009). In vitro 연구를 통해 지방 조직에서 Fgf21의 기전은 혈당 강하 효과와 더불어 인슐린 감수성(insulin-sensitizing) 효과를 나타내는 데 중요함을 밝혀냈고, 이 과정에서 특히 갈색지방 조직으로 상당한 glucose uptake가 일어나는 것이 확인되었다(Ding et al., 2012; BonDurant et al., 2017). Lactobacillus plantarum 유산균을 이용한 여주 발효체의 우수성은 Wen가 발표한 전임상 실험에서 또한 밝혀진 바 있다. 발효 여주에서 분리한 다당류와 비발효 여주 다당류를 비만 쥐에 투여하여 발효 전/후 항비만 효능 특성을 비교한 실험 결과, 발효 여주 다당류에서 비만쥐의 인슐린 저항성 및 지방 축적 완화 효과가 더 뛰어난 것으로 밝혀졌다(Wen et al., 2019). 생물발효 공정을 통해 다당류와 같은 식품 성분이 생체 변형이 일어나 생리적 기능이 향상된 것이다. 본 연구는 특정 물질의 분리 과정 없이 발효물을 직접 처리했다는 점과 차이가 있으나, in vivo 실험에서도 유산균 여주 발효체가 항비만 및 항당뇨 효능을 나타낸다는 것에 의의가 있다. 여주 유산균 발효체의 갈색지방화를 통한 항비만 메커니즘은 본 연구에 의해 처음 밝혀졌다.

췌장베타세포가 손상을 입는 원인은 여러 가지가 있지만 그 중 산화적 스트레스(oxidative stress)가 많이 알려져 있고, 이로 인한 점진적인 췌장베타세포 기능 이상은 제2형 당뇨병에서 인슐린 저항성을 더욱 증가시킨다(Coyle and Puttfarcken, 1993; West, 2000; Lee et al., 2007). 산화적 스트레스는 체내 활성산소종(reactive oxygen species, ROS)이 많이 생성되거나 항산화 시스템의 기능이 저하되면서 체내 산화계와 항산화계의 불균형으로 일어나는 것으로 알려져 있는데, 당뇨병의 발생으로 고혈당이 지속되면 free radical (H2O2, O2-, HO- )이 생성되어 산화적 스트레스를 유발하여, 이로 인한 췌장베타세포의 파괴와 기능 이상을 일으키게 됨으로써 당뇨병이 심화되거나 당뇨병성 망막병증, 당뇨병성 신증, 말초 신경병증, 당뇨발 등 합병증을 유발된다(Ishige et al., 2001; Laybutt et al., 2002; Gurgul-Convey et al., 2016). 본 연구에서는 산화적 스트레스 유발물질로 t-butyl hydroperoxide (TBHP)을 사용하여 췌장베타세포인 INS-1 cell에 손상을 유발하였으며, 이런 산화적 손상으로부터 여주 침지물과 여주 유산균 발효체가 보호활성을 가지는지 확인하였다. 그 결과 두 물질 모두 ROS를 효과적으로 감소시켜 췌장베타세포를 보호하는 것으로 나타났다.

인체에서 포도당은 일차적인 에너지원이자, 췌장베타세포의 주요 조절인자로 췌장베타세포 주기능은 혈액의 포도당 농도를 인식하여 인슐린을 분비를 조절함으로써 혈당을 정상범위로 유지하는 데 있다. 그러나 고농도 혈당에 장기간 노출되게 되면 췌장베타세포는 혈당조절의 장애가 발생하고 결국 파괴된다(Gurgul-Convey et al., 2016). 이를 당독성(glucose toxicity)이라고 하며, 인슐린 유전자 발현의 감소 및 인슐린 합성이 저해되어 궁극적으로 제 2형 당뇨의 주요한 2차적 병인이 되고 있다(Eguchi et al., 2021). 본 연구결과, 여주 침지물과 여주 유산균 발효체는 췌장베타세포의 세포 생존율을 증가시켰으며, 여주 유산균 발효체는 당독성 조건에서 또한 인슐린 분비를 자극하는 것으로 나타났다. 이러한 연구 결과는 여주 유산균 발효체가 인슐린 저항성을 효과적으로 개선하면서 장기복용 시에 췌장베타세포의 보호기능을 가지는 항당뇨 소재로서 개발될 수 있는 기초적 자료가 될 것이다.

γ-Aminobutyric acid (GABA)는 단백질을 구성하지 않는 기능성 아미노산으로 glutamic acid로부터 glutamate decarboxylase (GAD) 촉매로 탈탄산되어 생합성되는 중요한 생리활성 물질이다(Kook and Cho, 2013). GABA는 혈중 콜레스테롤 및 중성지방 증가 억제, 이뇨제, 혈압 강하제, 진정제, 항당뇨 효과 등의 여러 생리활성을 가지며, 특히, 뇌 세포에서 억제성 신경전달물질로 이용되어 산소 공급을 증가하고 뇌 혈류를 활성화함으로써 뇌 세포 대사를 촉진하는 것으로 알려져 있어 약리적으로 매우 주목받는 물질이다. 이러한 GABA의 역할로 인해 최근에 기능성 식품소재로서의 GABA에 대한 관심이 고조되고 있다. 유산균은 GABA를 생산하는 주요 생물체 중 하나이며, 이는 Lactobacillus brevis, L. plantarum, L. rhamnosus와 같은 Lactobacillus 속의 여러 유산균이 glutamate decarboxylase (GAD) 시스템을 가지고 있기 때문이다(Sa et al., 2015; Wu and Shah, 2017; Lee et al., 2018; Lim et al., 2018). GABA 생산 유산균은 여러 발효 식품으로부터 분리 가능하며, GABA를 생산하는 유산균을 이용한 기능성 발효식품 개발 연구가 폭넓게 진행되고 있다. 예를 들면, 우리나라의 대표적인 발효식품인 묵은지 김치로부터 GABA 생산능이 높은 유산균을 분리하여 김치 발효에 이용한다거나, GABA 생산 능력을 가지는 유산균을 유제품 발효의 스타터(Starter)로 이용하여 GABA가 첨가된 기능성 식품을 생산하는 것이다(Cho et al., 2011; Wu and Shah, 2017; Lee et al., 2018). 본 연구 결과 여주 유산균 발효에 의해 수용성 GABA 함량이 증가된 것을 알 수 있었다. 이는 여주열매가 유산균 발효를 통하여 항산화, 항당뇨 등 관련 효능을 증가시킬 수 있다는 것을 시사해 준다.

결론적으로 여주 열매는 CBT-LP3 유산균 발효에 의해서 GABA의 함량과 항당뇨 및 항비만 효과가 증가되었다. 이는 효능이 향상된 고부가가치의 여주 제품 개발에 유용한 자료로 활용될 것으로 사료된다.

적 요

본 연구에서는 다양한 생리적, 약리적 효능을 가지고 있는 것으로 알려진 여주의 효능을 더욱 증가시켜 고부가가치를 지닌 기능성 원료로써 활용하고자, 자사 특허 유산균 Lactobacillus plantarum CBT-LP3를 이용하여 발효시킨 후 그 추출물의 항당뇨 활성 및 항비만 활성을 평가하였다. 항당뇨 활성에 있어 여주 유산균 발효체는 3T3-L1 지방 세포의 2-deoxyglucose 흡수를 1 µM의 인슐린 보다 1.8 배 높게 증가시켰다. 반면 동일 농도의 비발효체 여주침지물은 대조군과의 유의적인 차이가 없었다. 뿐만 아니라 여주 유산균 발효체는 고농도 당독성에 대한 INS-1 췌장베타세포의 인슐린 분비 기능 부전효과를 완화시켰으며, 산화적 스트레스로부터 췌장베타세포의 생존율을 효과적으로 보호하는 것을 확인할 수 있었다. 항비만 측면에 있어 여주 유산균 발효체는 3T3-L1세포의 지방구 크기 감소와 갈색지방으로의 유전자 변화를 통해 항비만 효과를 나타내는 것으로 확인되며, 이는 본 논문에서 처음 밝혀졌다. 항당뇨, 항산화 활성물질로 알려진 γ-Aminobutyric acid (GABA)의 발효 전/후 함량을 분석한 결과, 유산균 발효를 통해 약 15%의 함량 증가가 확인되었다. 결론적으로 여주 열매는 CBT-LP3 유산균 발효에 의해 GABA의 함량과 항당뇨 및 항비만 효과가 증가되었으며, 이를 활용한 기능성 식품 또는 천연물 등으로 활용 가치가 있다 판단된다.

Acknowledgments

None.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References
  1. Atkinson MA and Maclaren NK. 1994. The pathogenesis of insulin-dependent diabetes mellitus. N. Engl. J. Med. 331, 1428-1436.
    Pubmed CrossRef
  2. Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS, and Maratos-Flier E. 2007. Hepatic fibroblast growth factor 21 is regulated by PPARα and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab. 5, 426-437.
    Pubmed CrossRef
  3. Bae JH, Han KD, Ko SH, Yang YS, Choi JH, Choi KM, Kwon HS, and Won KC. 2022. Diabetes fact sheet in Korea 2021. Diabetes Metab. J. 46, 417-426.
    Pubmed KoreaMed CrossRef
  4. BonDurant LD, Ameka M, Naber MC, Markan KR, Idiga SO, Acevedo MR, Walsh SA, Ornitz DM, and Potthoff MJ. 2017. FGF21 regulates metabolism through adipose-dependent and -independent mechanisms. Cell Metab. 25, 935-944.
    Pubmed KoreaMed CrossRef
  5. Cho EH, Koh EH, Kim MS, Park JY, and Lee KU. 2006. Mitochondrial dysfunction and insulin resistance. Diabetes Metab. J. 30, 409-415.
  6. Cho SY, Park MJ, Kim KM, Ryu JH, and Park HJ. 2011. Production of high γ-aminobutyric acid (GABA) sour Kimchi using lactic acid bacteria isolated from mukeunjee kimchi. Food Sci. Biotechnol 20, 403-408.
    CrossRef
  7. Coyle JT and Puttfarcken P. 1993. Oxidative stress, glutamate and neurodegenerative disorders. Science 262, 689-695.
    Pubmed CrossRef
  8. DeFronzo RA. 2004. Pathogenesis of type 2 diabetes mellitus. Med. Clin. North Am. 88, 787-835.
  9. Ding X, Boney-Montoya J, Owen BM, Bookout AL, Coate KC, Mangelsdorf DJ, and Kliewer SA. 2012. βKlotho is required for fibroblast growth factor 21 effects on growth and metabolism. Cell Metab. 16, 387-393.
    Pubmed KoreaMed CrossRef
  10. Eguchi N, Vaziri ND, Dafoe DC, and Ichii H. 2021. The role of oxidative stress in pancreatic β cell dysfunction in diabetes. Int. J. Mol. Sci. 22, 1509.
  11. Fakhoury H, Osman S, Ghazale N, Dahdah N, El-Sibai M, and Kanaan A. 2018. Enhanced glucose uptake in phenylbutyric acid-treated 3T3-L1 adipocytes. Cell Tiss. Biol. 12, 48-56.
    CrossRef
  12. Fan M, Kim EK, Choi YJ, Tang Y, and Moon SH. 2019. The role of Momordica charantia in resisting obesity. Int. J. Environ. Res. Public Health 16, 3251.
  13. Fuller R. 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66, 365-378.
  14. Golan T., Parikh R., Jacob E., Vaknine H., Zemser-Werner V., Hershkovitz D., Malcov H., Leibou S., Reichman H., and Sheinboim D.Sheinboim D., et al. 2019. Adipocytes sensitize melanoma cells to environmental TGF-β cues by repressing the expression of miR-211. Sci. Signal. 12, eaav6847.
    Pubmed CrossRef
  15. Goldin BR. 1998. Health benefits of probiotics. Br. J. Nutr. 80, S203-S207.
    CrossRef
  16. Goo KS, Ashari S, Basuki N, and Sugiharto AN. 2016. The bitter gourd Momordica charantia L.: morphological aspects, charantin and vitamin C contents. IOSR J. Agric. Vet. Sci. 9, 76-81.
    CrossRef
  17. Gurgul-Convey E, Mehmeti I, Plötz T, Jörns A, and Lenzen S. 2016. Sensitivity profile of the human EndoC-βH1 beta cell line to proinflammatory cytokines. Diabetologia 59, 2125-2133.
    Pubmed CrossRef
  18. Han SK. 2005. Quality improvement of effective microorganisms (EM) pork produced by using EM. J. Korean Soc. Food Sci. Nutr. 34, 734-737.
    CrossRef
  19. Hubert J, Berger M, Nepveu F, Paul F, and Dayd J. 2008. Effects of fermentation on the phytochemical composition and antioxidant properties of soy germ. Food Chem. 109, 709-721.
    Pubmed CrossRef
  20. Hue JJ, Kim JS, Kim J, Nam SY, Yun YW, Jeong JH, and Lee BJ. 2009. Antiglycemic effect of carnosine in diabetic mice. J. Food Hyg. Saf. 24, 391-397.
  21. Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, and Esser VEsser V, et al. 2007. Endocrine regulation of the fasting response by PPARα-mediated induction of fibroblast growth factor 21. Cell Metab. 5, 415-425.
    Pubmed CrossRef
  22. Ishige K, Schubert D, and Sagara Y. 2001. Flavonoids protect neuronal cells from oxidative stress by three distinct mechanisms. Free Radic. Biol. Med. 30, 433-446.
    Pubmed CrossRef
  23. Jia S, Shen M, Zhang F, and Xie J. 2017. Recent advances in Momordica charantia: functional components and biological activity. Int. J. Mol. Sci. 18, 2555.
  24. Jiang S, Yan C, Fang QC, Shao ML, Zhang YL, Liu Y, Deng YP, Shan B, Liu JQ, and Li HTLi HT, et al. 2014. Fibroblast growth factor 21 is regulated by the IRE1α-XBP1 branch of the unfolded protein response and counteracts endoplasmic reticulum stress-induced hepatic steatosis. J. Biol. Chem 289, 29751-29765.
  25. Jimenez V, Jambrina C, Casana E, Sacristan V, Muñoz S, Darriba S, Rodó J, Mallol C, Garcia M, and León XLeón X, et al. 2018. FGF21 gene therapy as treatment for obesity and insulin resistance. EMBO Mol. Med. 10, e8791.
  26. Jung HK. 2001. Selection criteria for probiotics and their industrial applications. Bioindustry News 14, 39-48.
  27. Jung YM, Ku SK, Lee DS, and Kwon K. 2017. Lactobacillus plantarum-fermented Opuntia humifusa extracts (fOH) increases the anti-obesity activity in mice fed a 45% Kcal high fat diet. J. Life Sci. 27, 680-687.
  28. Kim BJ, Jo SK, Jeong YS, and Jung HK. 2015. Anti-diabetic effects of Allium tuberosum rottler extracts and lactic acid bacteria fermented extracts in type 2 diabetic mice model. Korean J. Food Preser. 22, 134-144.
    CrossRef
  29. Kim KH, Kim DM, Byun MW, Yun YS, and Yook HS. 2013. Antioxidant activity of Panax ginseng flower-buds fermented with various microorganisms. J. Korean Soc. Food Sci. Nutr. 42, 663-669.
    CrossRef
  30. Kim JH, Kim MJ, Park HS, Kim YS, and Cho EJ. 2019. Membrane free stem cell extract from adipose tissue enhances glucose uptake in 3T3-L1 cells. J. Korean Med. Obes. Res. 19, 89-96.
    CrossRef
  31. Kim NM and Lee JS. 2003. Effect of fermentation periods on the qualities and physiological functionalities of the mushroom fermentation broth. Korean J. Mycol. 31, 28-33.
    CrossRef
  32. Kook MC and Cho SC. 2013. Production of GABA (gamma amino butyric acid) by lactic acid bacteria. Food Sci. Anim. Resour. 33, 377-389.
    CrossRef
  33. Korea Food and Drug Administration. Food standards codex. Korea Foods Industry Association, Seoul, Republic of Korea.
  34. Korean Diabetes Association. Diabetes fact sheet in Korea 2022. Korean Diabetes Association, Seoul, Republic of Korea.
  35. Kwak SH and Kim YH. 2018. Anti-adipogenic effect of 1-O-feruloyl-β-D-glucose on 3T3-L1 preadipocytes. Food Sci. Preserv. 25, 689-695.
  36. Laybutt DR, Kaneto H, Hasenkamp W, Grey S, Jonas JC, Sgroi DC, Groff A, Ferran C, Bonner-Weir S, and Sharma ASharma A, et al. 2002. Increased expression of antioxidant and antiapoptic genes in is lets that may contribute to β-cell survival during chronic hyperglycemia. Diabetes 51, 413-456.
    Pubmed CrossRef
  37. Lee HW. 2008. DPP-4 inhibitors and the relations between rosiglitazone and the risk of myocardial infarction. J. Korean Med. Assoc. 51, 371-376.
    CrossRef
  38. Lee JY, Kang JR, and Whang WK. 2007. Antioxidant activity of MeOH extract of aerial part from Agastache rugosa O. Kuntze. J. Korean Soc. Cosmetol. 13, 1396-1403.
  39. Lee MG and Kwon R. 2020. Anticancer activity of bispidinone derivative by apoptosis. Biomed. Sci. Lett. 26, 336-343.
    CrossRef
  40. Lee HJ, Moon JH, Lee WM, Lee SG, Kim AK, Woo YH, and Park DK. 2012. Charantin contents and fruit characteristics of bitter gourd (Momordica charantia L.) accessions. J. Bio-Env. Con 21, 379-384.
    CrossRef
  41. Lee KW, Shim JM, Yao Z, Kim JA, and Kim JH. 2018. Properties of kimchi fermented with GABA-producing lactic acid bacteria as a starter. J. Microbiol. Biotechnol 28, 534-541.
    Pubmed CrossRef
  42. Li YY, Stewart DA, Ye XM, Yin LH, Pathmasiri WW, McRitchie SL, Fennell TR, Cheung HY, and Sumner SJ. 2019. A metabolomics approach to investigate kukoamine B-A potent natural product with anti-diabetic properties. Front. Pharmacol. 9, 1575.
    Pubmed KoreaMed CrossRef
  43. Lim HS, Seo DH, Cha IT, Lee HJ, Nam YD, and Seo MJ. 2018. Expression and characterization of glutamate decarboxylase from Lactobacillus brevis HYE1 isolate from kimchi. World J. Microbiol. Biotechnol. 34, 44.
    Pubmed CrossRef
  44. Moon JH, Choi DW, Kim SE, Seomoon JH, Hong SY, Kim HK, Cho KM, Song J, Kang SS, Kim KH, and Kwon OK. 2015. Comparison of biological activities of ethanol extracts of unripe fruit of bitter melon (Momordica charantia L.) cultivated in Hamyang, Korea. J. Korean Soc. Food Sci. Nutr. 44, 1637-1644.
    CrossRef
  45. Ola MS, Al-Dosari D, and Alhomida AS. 2018. Role of oxidative stress in diabetic retinopathy and the beneficial effects of flavonoids. Curr. Pharm. Des. 24, 2180-2187.
    Pubmed CrossRef
  46. Pajak B, Siwiak E, Sołtyka M, Priebe A, Zieliński R, Fokt I, Ziemniak M, Jaśkiewicz A, Borowski R, and Domoradzki TDomoradzki T, et al. 2019. 2-Deoxy-d-glucose and its analogs: from diagnostic to therapeutic agents. Int. J. Mol. Sci. 21, 234.
    Pubmed KoreaMed CrossRef
  47. Qiao Y, Zhang L, Hou C, and Li F. 2021. Platycodin D protects pancreatic β-cells from STZ-induced oxidative stress and apoptosis. Food Sci. Technol. 42, e63521.
    CrossRef
  48. Sa HD, Park JY, Jeong SJ, Lee KW, and Kim JH. 2015. Characterization of glutamate decarboxylase (GAD) from Lactobacillus sakei A156 isolated from Jeot-gal. J. Microbiol. Biotechnol. 25, 696-703.
    Pubmed CrossRef
  49. Salimifar M, Fatehi-Hasanabad Z, and Fatehi M. 2013. A review on natural products for controlling type 2 diabetes with an emphasis on their mechanisms of actions. Curr. Diabetes Rev. 9, 402-411.
    Pubmed CrossRef
  50. Seo SH, Park GK, and Park JD. 2020. Korean ginseng and diabetes: an insight into antidiabetic effects of Korean Ginseng (Panax ginseng C. A. Meyer) in cultured cells, animal models and human studies. Korean J. Pharmacogn. 51, 1-29.
  51. Seok JH, Lee SY, Chae EJ, and Choi SW. 2010. Skin whitening effects of Caragana sinica Rehder extract fermented by Saccharomyces cerevisiae KCTC 7913. J. Soc. Cosmet. Scientists Korea 36, 207-213.
  52. Sharma PP, Godhwani T, and Baskaran V. 2022. Anti-lipogenic and thermogenic potency of Padina tetrastromatica bioactives in hypertrophied 3T3-L1 cells and their efficacy based thermogenic food supplement to mitigate obesity. Algal Res. 65, 102695.
    CrossRef
  53. Song P. 2020. The metabolic effects of FGF21: from physiology to pharmacology. J. Life Sci. 30, 640-650.
  54. Stock MJ and Cinti S. 2003. ADIPOSE TISSUE/Structure and Function of Brown Adipose Tissue, pp. 29-34. In Caballero B (eds.). Encyclopedia of Food Sciences and Nutrition. 2nd edn. Academic Press, San Diego, California, USA.
    CrossRef
  55. Tan SY, Mei Wong JL, Sim YJ, Wong SS, Mohamed Elhassan SA, Tan SH, Ling Lim GP, Rong Tay NW, Annan NC, and Bhattamisra SKBhattamisra SK, et al. 2019. Type 1 and 2 diabetes mellitus: a review on current treatment approach and gene therapy as potential intervention. Diabetes Metab. Syndr. 13, 364-372.
    Pubmed CrossRef
  56. Tan H, Yue T, Chen Z, Wu W, Xu S, and Weng J. 2023. Targeting FGF21 in cardiovascular and metabolic diseases: from mechanism to medicine. Int. J. Biol. Sci. 19, 66-88.
    Pubmed KoreaMed CrossRef
  57. Wang Y, Zhang Y, Wang Y, Peng H, Rui J, Zhang Z, Wang S, and Li Z. 2017. WSF-P-1, a novel AMPK activator, promotes adiponectin multimerization in 3T3-L1 adipocytes. Biosci. Biotechnol. Biochem. 81, 1529-1535.
    Pubmed CrossRef
  58. Wen JJ, Gao H, Hu JL, Nie QX, Chen HH, Xiong T, Nie SP, and Xie MY. 2019. Polysaccharides from fermented Momordica charantia ameliorate obesity in high-fat induced obese rats. Food Funct. 10, 448-457.
    Pubmed CrossRef
  59. West IC. 2000. Radical and oxidative stress in diabetes. Diabet. Med. 17, 171-180.
  60. Wu Q and Shah NP. 2017. High γ-aminobutyric acid production from lactic acid bacteria: emphasis on Lactobacillus brevis as a functional dairy starter. Crit. Rev. Food Sci. Nutr. 57, 3661-3672.
  61. Xu J, Stanislaus S, Chinookoswong N, Lau YY, Hager T, Patel J, Ge H, Weiszmann J, Lu SC, and Graham MGraham M, et al. 2009. Acute glucose-lowering and insulin-sensitizing action of FGF21 in insulin-resistant mouse models--association with liver and adipose tissue effects. American journal of physiology. Am. J. Physiol. Endocrinol. Metab. 297, 1105-1114.
    Pubmed CrossRef
  62. Yoon SM and Pyo YH. 2022. The in vitro antioxidant and antidiabetic activity of various fractions from monascus-fermented ginger extract. J. Korean Soc. Food Sci. Nutr. 51, 125-133.
    CrossRef


March 2024, 60 (1)