search for




 

Recombinant expression and purification of α-carbonic anhydrases from a water bear Ramazzottius varieornatus in Escherichia coli
Korean J. Microbiol. 2023;59(3):204-213
Published online September 30, 2023
© 2023 The Microbiological Society of Korea.

Ye Jin Choi1,2 and Byung Hoon Jo1,2,3*

1Division of Applied Life Science, Gyeongsang National University, Jinju 52828, Republic of Korea
2ABC-RLRC, Gyeongsang National University, Jinju 52828, Republic of Korea
3Division of Life Science and Research Institute of Life Science, Gyeongsang National University, Jinju 52828, Republic of Korea
Correspondence to: *E-mail: jobh@gnu.ac.kr; Tel.: +82-55-772-1321; Fax: +82-55-772-2553
Received August 17, 2023; Revised September 13, 2023; Accepted September 18, 2023.
Abstract
Carbonic anhydrase (CA) is an enzyme that catalyzes the reversible hydration of CO2, effectively accelerating carbon capture, utilization, and storage (CCUS) processes to achieve carbon neutrality. The discovery and utilization of stable CA is essential for efficient and cost-effective CCUS. Ramazzottius varieornatus, a species of tardigrade, is resistant to various physical and chemical stresses, and CAs from this species are expected to be stable under these stressful conditions. In this study, for the first time, we attempted the recombinant expression and purification of six α-CAs (RvCAs) from R. varieornatus in Escherichia coli. Additionally, we tested the expression of RvCAs with a fusion of the NEXT tag to enhance the soluble expression. With the exception of RvCA5, all of the recombinant RvCAs showed mostly insoluble expression. Subsequently, RvCA5 and NEXT-RvCA5, which were expressed mostly in soluble forms, were successfully purified. The catalytic activity of RvCA5 was found to be extremely low for both ester hydrolysis and CO2 hydration. Subsequent studies on RvCA5 will be interesting in terms of enzyme activity and stability, and further research on the remaining RvCA enzymes is anticipated to uncover novel stable CAs.
Keywords : Escherichia coli, Ramazzottius varieornatus, carbonic anhydrase, NEXT tag, recombinant expression
Body

대표적인 온실 가스인 이산화탄소(CO2)의 대기 중 농도는 산업혁명 이후 지속적으로 증가하고 있다. 이는 주로 인간 활동에 의한 화석 연료로부터 CO2 배출에 의해 발생하며, 인간과 자연 모두에 큰 위협을 가하는 가장 중요한 글로벌 이슈 중 하나이다. 탄소 중립을 실현하기 위해서는 탄소 포집·활용·저장(CCUS) 기술이 필수적으로 활용되어야 하며 이를 통해 CO2가 포집되어 영구적으로 저장되거나 높은 부가가치의 화합물로 전환될 수 있다. 하지만 CCUS 공정에서는 CO2가 수화되어 HCO3-가 형성되는 반응 또는 이의 역반응을 반드시 거치게 되는데 이들의 전환 속도는 매우 느리므로, CCUS 기술을 성공적으로 적용하기 위해서는 이를 가속화하는 촉매가 필요하다(Talekar et al., 2022).

Carbonic anhydrase (CA)는 CO2 수화 반응 및 HCO3- 탈수 반응을 촉진시키는 효소이다(Smith and Ferry, 2000). CA는 모든 생물 영역에 걸쳐 광범위하게 존재하며 CO2 수송, CO2 생광물화, pH 항상성 유지, 광합성 등 다양한 생물 현상에서 중요한 역할을 수행한다. CA는 α, β, γ, δ, ζ, η, θ, ι 등 8개의 클래스로 분류되며 이들 중 α-CA가 가장 잘 알려져 있다(Hirakawa et al., 2021). CA를 활용할 경우 다양한 CCUS 공정에서 CO2와 HCO3-의 전환을 가속화할 수 있으므로 CA는 CCUS를 위한 친환경 생촉매로 각광받고 있다(Talekar et al., 2022). 하지만 효율적인 CCUS를 위해서는 높은 공정 온도 또는 고농도의 K2CO3와 같은 고염 조건 등 다양한 스트레스 환경에서 효소가 작용해야 하므로 안정성이 뛰어난 CA의 발굴이 필요하다(Alvizo et al., 2014; Jo et al., 2018).

Tardigrade는 물곰이라 불리는 매우 작은 크기의 동물로 온도, 압력, 방사능, 탈수 등 극한의 물리적·화학적 스트레스 환경에 잘 견디는 것으로 유명하다. Ramazzottius varieornatus는 물곰의 한 종으로 최근 그 유전체 해독이 완료되었다(Hashimoto et al., 2016). Ramazzottius varieornatus가 지닌 단백질에 대한 연구는 주로 방사능에 대한 저항성을 부여하는 Dsup에 국한되어 있으며 최근 superoxide dismutase, cytochrome b5, secretory abundant heat-soluble (SAHS) 단백질 등 소수의 단백질에 대한 연구가 진행되었다(Hashimoto et al., 2016, 2020; Sim and Inoue, 2023; Zarubin et al., 2023). 하지만 물곰이 지닌 CA에 대한 연구는 현재까지 수행된 바 없다.

Ramazzottius varieornatus의 유전체는 α 클래스로 추정되는 CA isozyme (RvCA) 8종의 유전자를 지니고 있다(Hashimoto et al., 2016). CA는 생명 활동에 필수적인 효소이므로 R. varieornatus가 다양한 스트레스 환경에서 생존하기 위해서는 RvCA가 높은 안정성을 지닐 것으로 예상된다. 본 연구에서는 이들 중 6종을 Escherichia coli 균주에서 발현 및 정제하고자 하였다. 또한 단백질 수용성 발현을 향상시키기 위해 NEXT 태그를 융합하여 발현 및 정제를 시도하였다. NEXT 태그는 53개의 아미노산으로 이루어진 강력한 수용성 발현 태그로서 융합된 목적 단백질의 특성에 큰 영향을 미치지 않으며 단백질의 수용성과 발현 수율을 향상시킬 수 있다(Hwang et al., 2021; Jo, 2022). 특히 NEXT 태그는 무정형 펩타이드(Intrinsically disordered peptide) 태그로서 주변의 단백질이 목적 단백질에 접근하는 것을 효과적으로 막아줄 수 있다. 물곰 유래의 CA에 관한 연구는 본 연구에서 최초로 수행된 것이며 연구 결과는 향후 RvCA의 생화학적 특성을 밝히기 위한 기초 정보와 도구를 제공할 것이다.

재료 및 방법

Escherichia coli 균주 및 발현 벡터 구축

재조합 발현 벡터 유지 및 증폭에 E. coli TOP10 균주가 사용되었고, 재조합 단백질 발현에는 E. coli BL21 (DE3) 균주가 사용되었다. Escherichia coli는 Luria-Bertani (LB) 배지에서 180 rpm 조건하에서 배양되었으며 필요에 따라 50 μg/ml ampicillin이 첨가되었다. RvCA 6종의 유전자(GenBank ID: RvCA1, GAU90911; RvCA2, GAU89155; RvCA3, GAU88508; RvCA4, GAU92027; RvCA5, GAU95394; RvCA6, GAU94994)는 화학적으로 합성되었으며 pUC57 벡터에 삽입되었다(GenScript). Codon adaptation index (CAI)는 모두 0.96 이상이었다. 신호 서열로 추정되는 서열은 유전자 합성 시 제외되었다. 합성된 유전자는 NdeI과 XhoI 제한효소 사이트를 이용하여 pET-22b(+) 벡터에 삽입되었다. 완성된 각 벡터는 pET-RvCA1 내지 pET-RvCA6로 명명하였다. NEXT 태그가 융합된 RvCA의 발현을 위해 RvCA 유전자를 PCR 증폭하였으며, 증폭된 유전자는 pGEM-T-Easy 벡터에 삽입되었다. Sequencing 확인 후 벡터는 NcoI과 XhoI 제한효소로 처리되었으며 각 유전자는 동일한 제한효소로 처리된 pET-NEXT-taCA 벡터에 클로닝되었다. 각 벡터는 pET-NEXT-RvCA1 내지 pET-NEXT-RvCA6로 명명하였다. 모든 재조합 유전자는 C-말단에 His6 태그를 지니고 있다. 본 연구에 사용된 균주, 벡터와 PCR을 위한 프라이머 서열은 Table 1에 정리되어 있다.

Strains, plasmids and primers used in this study
Strains, plasmids or primers Genotype, relevant characteristics or sequence Source or reference
Strains
E. coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) Ф80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG Thermo Fisher Scientific
E. coli BL21(DE3) F- ompT hsdSB(rB- mB-) gal dcm lon λ(DE3), carrying T7 RNA polymerase gene Novagen
Plasmids
pGEM-T Easy pUC ori, Ampr, TA cloning vector, Promega
pET-22b(+) T7lac promoter, pBR322 ori, Ampr, parental expression vector Novagen
pET-RvCA1~pET-RvCA6 Expression plasmid carrying RvCA gene This study
pET-NEXT-RvCA1~pET-NEXT-RvCA6 Expression plasmid carrying NEXT-RvCA gene This study
Primersa
RvCA1 Forward: CCATGGGCTGGTTCAAGTTTCAGGGTG This study
Reverse: CTCGAGTTGGCTAAAACGC
RvCA2 Forward: CCATGGGCAAGCTGAGCACCGC This study
Reverse: CTCGAGACCGTTACGC
RvCA3 Forward: CCATGGGCATCGAAATTCATCATGCGG This study
Reverse: CTCGAGCAGGCAAATGA
RvCA4 Forward: CCATGGCGGGTCGTTG This study
Reverse: CTCGAGCAGCTGGG
RvCA5 Forward: CCATGGGCTTCGAGGACAGCTGG This study
Reverse: CTCGAGGCTGGTAAATTTC
RvCA6 Forward: CCATGGGCCAGAACGTTAGCAACCTG This study
Reverse: CTCGAGCAGTTTAATCACG

a Restriction sites are underlined.



재조합 단백질의 발현

각 벡터를 E. coli BL21 (DE3)에 도입하고 50 μg/ml ampicillin이 추가된 LB 배지에서 37°C, 180 rpm 조건으로 10시간 종균 배양하였다. 각 항생제가 첨가된 200 ml LB 배지에 종균 배양액을 1% (v/v) 접종하였고 37°C에서 본 배양을 시작하였다. 세포의 농도가 OD600 = 0.6~0.8에 도달하였을 때 1 mM (37°C) 또는 0.1 mM (25°C)의 isopropyl-β-D-thiogalactopyranoside (IPTG; Duchefa Biochemie)를 첨가하였으며 이후 37°C 또는 25°C에서 180 rpm으로 추가 배양하였다. 배양 완료 후 배양액을 4°C, 4,000 × g에서 10분 간 원심 분리하여 세포를 회수하였다. 회수된 세포는 lysis buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0)에 재현탁하였다. 이들을 얼음물 상에서 초음파 파쇄하였으며, 파쇄액을 4°C, 10,000 × g에서 10분 간 원심분리한 후 상등액은 수용성 분획(soluble fraction, S)으로 명명하였고, pellet은 동일 부피의 lysis buffer로 재현탁하여 불용성 분획(insoluble fraction, IS)으로 명명하였다.

단백질 정제

수용성 분획을 Ni-NTA agarose bead (Qiagen)와 혼합 후 1시간 동안 반응시켰다. 이후 혼합물을 정제용 컬럼에 넣어 His6 태그 친화성 크로마토그래피를 수행하였다. Wash buffer (50 mM sodium phosphate, 300 mM NaCl, 20 mM imidazole, pH 8.0)를 이용해 wash 과정을 진행하였고 elution buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0)를 이용해 bead에 붙은 단백질을 elution하였으며 정제된 단백질은 정제 단백질 분획(purified protein fraction, P)으로 명명하였다. 정제된 단백질은 최종적으로 dialysis buffer (20 mM sodium phosphate, pH 7.5)에서 투석을 진행하였다. 정제된 단백질의 수용성 비교를 위해 경우에 따라 dialysis buffer에는 300 mM NaCl이 추가되었다. 투석이 완료된 단백질 용액을 4°C, 10,000 × g에서 10분 간 원심분리하여 상등액(supernatant, Sup)과 침전물(precipitate, Ppt)로 분획하였다. 정제된 효소 상등액의 정량을 위해 bovine serum albumin(BSA; Sigma-Aldrich)을 표준 단백질로 하여 Bradford assay (Bio-Rad)를 이용하였다. 이후 효소 활성 측정에는 정제된 효소 상등액을 이용하였다.

SDS-PAGE 분석

준비된 샘플을 4× sample buffer (Bio-Rad)와 3:1의 부피비로 혼합하여 100°C에서 10분 간 가열하였다. 15% Tris-glycine gel에서 전기영동을 실시하였으며 이후 0.1% Coomassie Brilliant Blue R-250 (Bio-Rad)으로 gel을 염색하였다.

CA 활성 측정

Esterase 활성은 p-nitrophenyl acetate (p-NPA)를 기질로 사용하여 25°C에서 측정하였다(Kim and Jo, 2022). 800 μl의 reaction buffer (20 mM sodium phosphate, pH 7.5), 100 μl의 정제된 효소 용액, 그리고 acetonitrile에 녹인 30 mM의 p-NPA 100 μl를 섞은 후 quartz cuvette 상에서 온도 조절 가능한 UV-Vis spectrophotometer (Shimadzu)로 p-NPA의 분해 반응을 348 nm에서의 흡광도 변화로 측정하였다. 자연적인 p-NPA 가수 분해 속도는 정제 효소 용액 대신 동일 부피의 dialysis buffer를 이용하여 측정하였으며, 이를 효소 첨가 시 분해 속도에서 빼 주어 최종적인 효소 반응에 의한 p-NPA 분해 속도를 얻었다. 활성 계산을 위해 p-NPA의 분해 산물인 p-nitrophenol (p-NP)의 348 nm에서의 흡광계수인 5000 M-1·cm-1를 사용하였다.

CO2 수화 활성은 CO2-saturated water를 기질로 하여 pH 변화에 따른 phenol red 색 변화를 측정하는 colorimetric 방식으로 측정하였다(Kim and Jo, 2022). 일회용 cuvette 상에서 100 μM의 phenol red (Sigma-Aldrich)가 첨가된 20 mM Tris buffer (pH 8.3) 600 μl와 정제 효소 용액 50 μl를 섞은 뒤 얼음물 상에서 준비한 CO2-saturated water를 400 μl 첨가하여 반응을 시작하였다. UV-Vis spectrophotometer를 이용하여 4°C에서 570 nm에서의 흡광도 변화를 측정하였다. 측정이 완료된 후, 흡광도가 pH 7.5에 해당하는 1.2에서 pH 6.5에 해당하는 0.18까지 떨어지는 데 걸리는 시간(tEnz)을 분석하였다. 자연적인 CO2 수화에 의해 pH가 변화하는 시간(tBlank)은 정제 효소 용액 대신 동일한 부피의 dialysis buffer를 이용하여 구하였다. Wilbur-Anderson unit (WAU)은 (tBlank/tEnz – 1)를 계산하여 구하였다.

In silico 분석

단백질 서열 정보는 NCBI (https://www.ncbi.nlm.nih.gov/)로부터 얻었다. 단백질 특성 분석은 Protparam 서버(http://web.expasy.org/protparam/)를 이용하였다(Wilkins et al., 1999). RvCA signal peptide 분석에는 SignalP를 사용하였다(Teufel et al., 2022). Multiple sequence alignment에는 ClustalX를 이용하였으며(Larkin et al., 2007), visualization에는 ESPript 3.0 (https://espript.ibcp.fr/ESPript/ESPript/)을 이용하였다(Robert and Gouet, 2014). RvCA5의 입체구조 예측을 위해 I-TASSER를 이용하였으며(Yang et al., 2015), visualization에는 UCSF ChimeraX를 이용하였다(Pettersen et al., 2021). 입체구조 예측을 용이하게 하기 위해 RvCA5의 N-말단 extension (1-52) 및 C-말단 extension (331-347)을 제거한 서열을 사용하였다. TM-score는 0.79로서 이는 예측된 구조 모델이 정확한 topology를 가진다는 것을 의미한다.

결과 및 고찰

Multiple sequence alignment (MSA)를 통한 RvCA의 서열 특성 분석

Ramazzottius varieornatus 유전체에서 발견되는 8종의 RvCA를 각각 RvCA1 내지 RvCA8로 명명하였다. 이들을 기존에 알려진 대표적인 α-CA인 human CAII (hCAII) 및 Neisseria gonorhoeae CA (ngCA)와 MSA를 수행하였다(Fig. 1). Active site의 zinc와 배위결합하는 3개의 His 잔기를 포함하여 α-CA의 보존 잔기를 대부분 지니는 것으로 보아 RvCA는 α-CA로 분류될 수 있다. SignalP를 이용 예측 결과 RvCA5, RvCA7, RvCA8을 제외한 다른 RvCA는 signal peptide를 지니는 것으로 예상되었다. 64번(hCAII 서열 번호 기준) His 잔기는 proton shuttle 역할을 수행하는 것으로 알려져 있는데(Smith and Ferry, 2000), RvCA2와 RvCA7의 경우 이 위치가 각각 Gln과 Tyr 잔기로 치환되어 있다. 64번 His 잔기가 활성에 매우 중요한 역할을 하지만 유일한 proton shuttle 잔기는 아니므로(Forsman et al., 1988) RvCA2와 RvCA7도 활성형의 효소일 것으로 추측된다.

Fig. 1. Multiple sequence alignment of RvCAs.
The α-CA sequences from Homo sapiens (hCAII; AAA51908) and Neisseria gonorrhoeae (ngCA; ASQ71418) are included. The predicted signal sequences are enclosed in green boxes. The two conserved cysteine residues for the formation of the intramolecular disulfide bond are indicated by a hash symbol (#). The three zinc ligand histidine residues (*) and proton shuttling histidine residue (●) are marked. The two ‘gate-keeper’ residues are indicated by an open circle (○). The hydrophobic pocket residues are marked by a closed triangle (▲).

54번와 207번(ngCA 서열 번호 기준) Cys 잔기 둘은 산화되어 α-CA에서 주로 나타나는 보존된 intramolecular disulfide bond를 형성하며 이는 효소의 안정성 유지에 매우 중요한 역할을 한다(Elleby et al., 2001). RvCA5의 경우 유일하게 이러한 보존된 Cys 잔기를 지니지 않으며 오히려 그 밖의 위치에 6개의 Cys 잔기를 지니고 있다(Table 2). RvCA5의 모델 구조 상 6개 Cys 잔기들은 intramolecular disulfide bond를 형성할 수 없는 위치에 분포되어 있음을 알 수 있다(Fig. 2). 이들의 RvCA5 효소 안정성에의 영향과 분자적/생리학적 기능과 역할에 대한 연구는 향후 흥미로운 주제가 될 것이다.

Fig. 2. Predicted three-dimensional structure of RvCA5 by I-TASSER.
The three zinc ligand histidine residues are colored pink. The six cysteine residues are colored yellow. For the modeling, RvCA5 sequence without both N-terminal (1-52) and C-terminal (331-347) extensions was used.

Properties of recombinant RvCAs used in this study
Protein lengtha Molecular weight (kDa) No. cysteine residues pI Net charge
Conserved Non-conserved
RvCA1 313 35.7 2 0 9.22 +6
RvCA2 346 38.6 2 0 6.22 -5
RvCA3 399 44.8 2 1 7.86 +1
RvCA4 352 40.3 2 1 6.36 -7
RvCA5 355 40.1 0 6 6.81 -3
RvCA6 333 37.4 2 0 6.40 -5

a This includes the starting Met, two amino acids (Leu-Glu) from XhoI site, and the six His residues from the His6-tag.



Escherichia coli 균주에서의 RvCA 발현 및 정제

본 연구에서는 8종의 RvCA 중 RvCA1부터 RvCA6까지 6종에 대해 E. coli에서 재조합 발현 및 정제를 시도하였다. 각 유전자는 signal peptide 서열을 포함하지 않도록 설계하여 E. coli 코돈 최적화를 거쳐 화학적으로 합성되었으며, T7lac 프로모터에 의해 조절되는 발현 벡터에 삽입되었다. 이들은 His6 태그를 포함하여 35.7 kDa에서 44.8 kDa 사이의 분자량을 지니는 것으로 계산되었는데(Table 2) 이는 기존에 알려진 일반적인 α-CA보다 크며 주로 RvCA에 특이적으로 존재하는 C-말단 extension 서열에 기인한다(Fig. 1). 각 플라스미드 벡터는 E. coli BL21 (DE3) 균주에 도입되었으며 IPTG를 이용하여 단백질 발현을 유도하였다.

37°C에서 RvCA를 발현한 결과, RvCA5가 일부 수용성 발현을 보인 것을 제외하면 모두 불용성 분획에 나타나거나 뚜렷한 발현을 보이지 않았다(Fig. 3A). 재조합 단백질을 37°C에서 과발현할 경우 빠른 속도의 transcription과 translation에 의해 잔기 사이의 소수성 상호작용이 증가하여 불용성 응집체를 형성할 수 있으므로(Sørensen and Mortensen, 2005) 발현 속도를 늦추고 소수성 상호작용을 감소시키기 위해 상대적으로 낮은 배양온도인 25°C에서 단백질 발현을 시도하였다. 그 결과, RvCA5의 경우 수용성 발현이 뚜렷하게 증가하였으나 나머지의 경우 모두 수용성 발현에는 큰 효과가 없었으며 대부분은 불용성 발현량 자체도 감소되는 경향을 보였다(Fig. 3B).

Fig. 3. Recombinant expression and purification of RvCAs.
(A) Expression at 37°C. (B) Expression at 25°C. Coomassie blue-stained SDS-PAGE gels are shown. The band position of each recombinant protein is indicated with the red dash squares. (C) Purification of RvCA5 via His6-tag affinity chromatography. (D) Precipitation pattern of RvCA5. The purified RvCA5 was dialyzed against 20 mM phosphate buffer with or without 300 mM NaCl. Lanes: MW, molecular mass marker; T, Total cell lysate; S, soluble fraction; IS, insoluble fraction; FT, flow-through faction; P, purified protein; Sup, supernatant after centrifugation; Ppt, precipitate after centrifugation.

25°C에서 RvCA5를 발현한 후 C-말단의 His6 태그를 이용한 affinity chromatography를 통해 효소를 정제하였으며, SDS-PAGE를 통해 RvCA5가 성공적으로 정제되었음을 확인하였다(Fig. 3C). 특이하게 full-length RvCA5 이외에 보다 작은 크기를 지닌 truncated 단백질들이 함께 정제되었으며 특히 약 35 kDa 부근에 나타난 1st truncated RvCA5 밴드는 full-length RvCA5와 유사한 정도로 높은 비율을 차지하였다(Fig. 3C). 이러한 truncated RvCA5들은 유전자 내 internal translation initiation에 의해 생성될 수 있으므로 UTR designer (Seo et al., 2013)를 이용하여 가능한 코돈 위치를 탐색하였으나 이에 해당하는 코돈은 발견되지 않았다. 따라서 정제된 truncated 단백질들은 E. coli 세포 내에서 일어난 proteolysis에 의해 서로 다른 위치에서 잘린 RvCA5의 C-말단 조각들인 것으로 추정되었다. 정제된 RvCA5를 낮은 ionic strength를 지닌 버퍼에 투석하였을 때 단백질의 대부분이 침전되었으며 300 mM NaCl이 첨가된 버퍼에 투석할 경우 수용성이 증가하였다(Fig. 3D). 이는 RvCA5 고유의 수용성이 상당히 낮다는 것을 보여준다.

NEXT 태그를 융합한 RvCA의 발현 및 정제

RvCA의 수용성 발현을 향상시키기 위해 NEXT 태그를 N-말단에 융합하여 발현을 시도하였다. 37°C에서 NEXT-RvCA를 발현한 결과, NEXT-RvCA5의 수용성 발현은 태그가 없는 경우와 비교하여 눈에 띄게 향상되었으며 NEXT-RvCA1과 NEXT-RvCA4를 제외한 경우 적은 양이나마 수용성 발현을 보였다(Fig. 4A). 25°C에서 발현한 결과, NEXT-RvCA5는 거의 모두 수용성 발현되었으며 NEXT-RvCA2도 37°C 대비 뚜렷한 발현 향상을 나타내었다(Fig. 4B). 따라서 NEXT 태그 융합은 RvCA의 수용성 발현 향상에 전반적으로 효과적인 전략임을 알 수 있다.

Fig. 4. Recombinant expression and purification of NEXT-RvCAs.
(A) Expression at 37°C. (B) Expression at 25°C. Coomassie blue-stained SDS-PAGE gels are shown. The band position of each recombinant protein is indicated with the red dash squares. (C) Purification of NEXT-RvCAs via His6-tag affinity chromatography. (D) Precipitation pattern of NEXT-RvCA5. The purified NEXT-RvCA5 was dialyzed against 20 mM phosphate buffer with or without 300 mM NaCl. Lanes: MW, molecular mass marker; T, Total cell lysate; S, soluble fraction; IS, insoluble fraction; FT, flow-through faction; P, purified protein; Sup, supernatant after centrifugation; Ppt, precipitate after centrifugation.

수용성 발현을 보이지 않은 NEXT-RvCA1과 NEXT-RvCA4를 제외한 나머지 4종 효소에 대해 25°C에서 발현 후 His6 태그를 이용한 affinity chromatography 정제를 시도하였다. NEXT-RvCA5를 제외한 나머지 효소는 모두 대부분의 단백질이 affinity resin에 binding하지 못하고 column을 통과해 나왔으며 이에 따라 매우 적은 양의 단백질만 얻어낼 수 있었다(Fig. 4C). 이는 이들 효소가 수용성 분획에 존재하기는 하지만 제대로 된 접힘 구조를 형성하지 못한 상태이며 이에 따라 resin binding에 필요한 His6 태그가 외부로 잘 노출되지 못하여 나타난 결과로 풀이된다. 또는 경우에 따라 NEXT 태그가 주변의 거대 분자가 접근하는 것을 막아주는 본연의 역할에 충실하여 효소가 resin에 binding하는 것을 방해함으로써 나타나는 현상일 가능성도 배제할 수는 없다. NEXT-RvCA5의 경우 대부분의 단백질이 resin에 binding하였으며 많은 양의 단백질이 성공적으로 정제되었다(Fig. 4C). 흥미로운 것은, 본래 매우 강하게 나타났던 35 kDa 부근의 1st truncated RvCA5 밴드가 NEXT 태그의 융합에 의해 눈에 띄게 줄어든 것이다(Fig. 4C). 이것은 NEXT 태그와 가장 가까이에 위치한 절단 부위인 1st truncated site로 해당 protease가 접근하는 것을 NEXT 태그가 효과적을 막아주어 나타난 결과로 풀이된다. 정제된 NEXT-RvCA5는 NaCl의 유무에 상관없이 모두 온전하게 수용성을 유지하였으며(Fig. 4D) 이는 NEXT 태그의 강력한 수용성 향상 기능을 보여준다.

RvCA5의 활성 테스트

충분한 양의 정제된 효소를 얻어낼 수 있었던 RvCA5와 NEXT-RvCA5에 대해 효소 활성 테스트를 진행하였다. 우선, α-CA는 일반적으로 esterase 활성을 지니는 것으로 알려져 있으므로 대표적인 ester 기질인 p-NPA를 이용하여 활성을 측정하였다(Fig. 5A). 3 mM p-NPA를 이용하여 25°C에서 측정한 결과 RvCA5는 9.4 ± 1.5 nmol p-NPA min-1·mg-1 protein의 활성을 보였으며 NEXT-RvCA5는 10.6 ± 0.7 nmol p-NPA min-1·mg-1 protein의 활성을 보였다. 이는 기존에 알려진 α-CA의 esterase 활성과 비교하여 매우 낮은 수치로서(Jo et al., 2018), RvCA5는 ester를 분해할 수 있지만 그 활성이 매우 약하다는 것을 보여준다.

Fig. 5. Catalytic activity of RvCA5 and NEXT-RvCA5.
(A) Esterase activity using p-NPA as the substrate. The formation of p-NP by the hydrolysis of p-NPA was monitored at 348 nm. (B) CO2 hydration activity using CO2-saturated water as the substrate. Phenol red was used as the pH indicator. The decrease of pH by the CO2 hydration reaction was monitored at 570 nm.

다음으로 효소의 CO2 수화 활성을 Wilbur-Anderson 방법으로 측정하였다(Fig. 5B). WA 방법은 CO2 수화 반응으로 발생하는 H+에 의한 pH 감소를 이용하여 효소 활성을 측정하는 방법으로서 1 WAU는 효소 없이 자연적인 CO2 수화 반응에 의해 나타나는 pH 감소 속도에 해당하는 활성을 나타낸다. 측정 결과 RvCA5는 18.7 ± 2.6 WAU/mg protein의 활성을, 그리고 NEXT-RvCA5는 15.4 ± 2.6 WAU/mg protein의 활성을 나타냈다. NEXT 태그 자체의 분자량을 고려했을 때, NEXT 융합에 의한 RvCA5 활성에의 영향은 거의 없다고 볼 수 있다. 이들 활성은 대표적인 α-CA인 bovine CA가 동일한 측정 환경에서 12,700 WAU/mg의 활성을 보인 것과 비교하여 극히 낮은 수치이며(Kim and Jo, 2022), RvCA5는 최소한 현재까지 활성 측정된 모든 α-CA 중 가장 낮은 활성을 나타내는 CA인 것으로 추정된다. Bovine CA와 더불어 높은 활성을 지닌 것으로 알려진 hCAII의 경우 active site의 zinc ligand인 His94와 His96은 Phe93, Phe95, Trp97에 끼여 있는데, 이러한 커다란 소수성 잔기들은 zinc에 대한 affinity에 큰 영향을 미치는 것으로 알려져 있다(Hunt and Fierke, 1997). 독특하게도 RvCA5에서는 93번째와 95번째 잔기 모두 더욱 작은 크기의 소수성 잔기인 Ile와 Ala로 각각 치환되어 있다(Fig. 1). 이러한 active site 근처의 구조적 변화가 RvCA5의 zinc affinity에 악영향을 미치며 결국 효소 활성을 낮춘 것으로 보인다. 야생형의 RvCA5는 극히 낮은 CO2 수화 활성을 지니므로 CCUS에 부적합하지만 RvCA5 효소의 안정성과 활성 증가의 관점에서 다양한 active site 변이체를 제작하여 테스트해 본다면 흥미로운 발견을 할 수 있을 것으로 기대된다. 또한 본 연구에서는 RvCA5 이외의 효소에 대한 추가적인 연구를 진행하지 못하였지만 향후 더욱 강력한 수용성 태그가 개발된다면 이들을 활용해 나머지 RvCA에 대한 재조합 과발현, 정제 및 특성 연구를 통해 CCUS에 적합한 CA를 발굴할 수 있을 것이라 기대된다.

적 요

Carbonic anhydrase (CA)는 CO2 수화 반응 및 HCO3- 탈수 반응을 촉진시키는 효소로서 탄소 중립을 실현하기 위한 탄소 포집·활용·저장(CCUS) 공정을 효과적으로 가속화할 수 있다. 효율적이며 경제적인 CCUS를 위해서는 안정성이 뛰어난 CA의 발굴이 필요하다. Ramazzottius varieornatus는 물곰의 일종으로 다양한 물리적·화학적 스트레스 환경에 잘 견딜 수 있으며 이 종이 지닌 CA는 이러한 스트레스 환경에서 안정할 것으로 기대된다. 본 연구에서는 최초로 R. varieornatus 유래의 α-CA (RvCA) 6종을 Escherichia coli에서 재조합 발현 및 정제를 시도하였다. 또한 단백질 수용성 발현을 향상시키기 위해 NEXT 태그를 융합하여 발현 테스트하였다. RvCA5를 제외한 나머지는 대부분 불용성 발현을 보였으며 결과적으로 높은 수용성 발현을 보인 RvCA5와 NEXT-RvCA5를 성공적으로 정제하였다. 이들의 ester 분해 활성과 CO2 수화 활성을 측정한 결과 RvCA5의 효소 활성은 극히 낮음을 확인하였다. RvCA5에 대한 후속 연구는 효소 활성과 안정성 측면에서 흥미로울 것이며 나머지 RvCA에 대해서도 후속 연구를 통해 안정성이 뛰어난 새로운 CA를 발굴할 수 있을 것으로 기대된다.

Acknowlegments

이 논문은 한국연구재단의 지원(NRF-2021R1F1A1057310, NRF-2021R1A5A8029490)을 받아 수행된 연구임.

Conflict of Interest

The authors have no conflict of interest to report.

References
  1. Alvizo O, Nguyen LJ, Savile CK, Bresson JA, Lakhapatri SL, Solis EOP, Fox RJ, Broering JM, Benoit MR, and Zimmerman SA, et al. 2014. Directed evolution of an ultrastable carbonic anhydrase for highly efficient carbon capture from flue gas. Proc. Natl. Acad. Sci. USA 111, 16436-16441.
    Pubmed KoreaMed CrossRef
  2. Elleby B, Chirica LC, Tu C, Zeppezauer M, and Lindskog S. 2001. Characterization of carbonic anhydrase from Neisseria gonorrhoeae. Eur. J. Biochem. 268, 1613-1619.
    Pubmed CrossRef
  3. Forsman C, Behravan G, Jonsson BH, Liang ZW, Lindskog S, Ren XL, Sandstrom J, and Wallgren K. 1988. Histidine 64 is not required for high CO2 hydration activity of human carbonic anhydrase II. FEBS Lett. 229, 360-362.
    Pubmed CrossRef
  4. Fukuda Y, Kim J, and Inoue T. 2020. Structure of cytochrome b5 unique to tardigrades. Protein Sci. 29, 1829-1835.
    CrossRef
  5. Fukuda Y, Miura Y, Mizohata E, and Inoue T. 2017. Structural insights into a secretory abundant heat-soluble protein from an anhydrobiotic tardigrade, Ramazzottius varieornatus. FEBS Lett. 591, 2458-2469.
    Pubmed CrossRef
  6. Hashimoto T, Horikawa DD, Saito Y, Kuwahara H, Kozuka-Hata H, Shin-I T, Minakuchi Y, Ohishi K, Motoyama A, and Aizu T, et al. 2016. Extremotolerant tardigrade genome and improved radiotolerance of human cultured cells by tardigrade-unique protein. Nat. Commun. 7, 12808.
    Pubmed KoreaMed CrossRef
  7. Hirakawa Y, Senda M, Fukuda K, Yu HY, Ishida M, Taira M, Kinbara K, and Senda T. 2021. Characterization of a novel type of carbonic anhydrase that acts without metal cofactors. BMC Biol. 19, 105.
    Pubmed KoreaMed CrossRef
  8. Hunt JA and Fierke CA. 1997. Selection of carbonic anhydrase variants displayed on phage. J. Biol. Chem. 272, 20364-20372.
    Pubmed CrossRef
  9. Hwang IS, Kim JH, and Jo BH. 2021. Enhanced production of a thermostable carbonic anhydrase in Escherichia coli by using a modified NEXT tag. Molecules 26, 5830.
    Pubmed KoreaMed CrossRef
  10. Jo BH. 2022. An intrinsically disordered peptide tag that confers an unusual solubility to aggregation-prone proteins. Appl. Environ. Microbiol. 88, e0009722.
    Pubmed KoreaMed CrossRef
  11. Jo BH, Im SK, and Cha HJ. 2018. Halotolerant carbonic anhydrase with unusual N-terminal extension from marine Hydrogenovibrio marinus as novel biocatalyst for carbon sequestration under high-salt environments. J. CO2 Util. 26, 415-424.
    CrossRef
  12. Kim JH and Jo BH. 2022. A colorimetric CO2 hydration assay for facile, accurate, and precise determination of carbonic anhydrase activity. Catalysts 12, 1391.
    CrossRef
  13. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, and Lopez R, et al. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-2948.
    Pubmed CrossRef
  14. Pettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, and Ferrin TE. 2021. UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci. 30, 70-82.
    Pubmed KoreaMed CrossRef
  15. Robert X and Gouet P. 2014. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 42, W320-W324.
    Pubmed KoreaMed CrossRef
  16. Seo SW, Yang JS, Kim I, Yang J, Min BE, Kim S, and Jung GY. 2013. Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency. Metab. Eng. 15, 67-74.
    Pubmed CrossRef
  17. Sim KS and Inoue T. 2023. Structure of a superoxide dismutase from a tardigrade: Ramazzottius varieornatus strain YOKOZUNA-1. Acta Cryst. 79, 169-179.
    CrossRef
  18. Smith KS and Ferry JG. 2000. Prokaryotic carbonic anhydrases. FEMS Microbiol Rev. 24, 335-366.
    Pubmed CrossRef
  19. Sørensen HP and Mortensen KK. 2005. Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb. Cell Fact. 4, 1.
  20. Talekar S, Jo BH, Dordick JS, and Kim J. 2022. Carbonic anhydrase for CO2 capture, conversion and utilization. Curr. Opin. Biotech. 74, 230-240.
    Pubmed CrossRef
  21. Teufel F, Almagro Armenteros JJ, Johansen AR, Gíslason MH, Pihl SI, Tsirigos KD, Winther O, Brunak S, and von Heijne G, et al. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 40, 1023-1025.
    Pubmed KoreaMed CrossRef
  22. Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, and Hochstrasser DF. 1999. Protein identification and analysis tools in the ExPASy server. In Link A.J. (ed.). 2-D Proteome Analysis Protocols. Methods in Molecular Biology, vol. 112. Humana Press, Totowa, New Jersey, USA.
    CrossRef
  23. Yang J, Yan R, Roy A, Xu D, Poisson J, and Zhang Y. 2015. The I-TASSER Suite: protein structure and function prediction. Nat. Methods 12, 7-8.
    Pubmed KoreaMed CrossRef
  24. Zarubin M, Azorskaya T, Kuldoshina O, Alekseev S, Mitrofanov S, and Kravchenko E. 2023. The tardigrade Dsup protein enhances radioresistance in Drosophila melanogaster and acts as an unspecific repressor of transcription. iScience 26, 106998.
    Pubmed KoreaMed CrossRef


March 2024, 60 (1)
Full Text(PDF) Free

Social Network Service
Services

Author ORCID Information

Funding Information
  • National Research Foundation of Korea
      10.13039/501100003725
      NRF-2021R1F1A1057310, NRF-2021R1A5A8029490