Search for


search for




 

Development of hair growth-promoting materials using a mixture of lactobacillus-fermented Seomoktae powder and new strains isolated from kimchi§
Korean J. Microbiol. 2024;60(1):26-34
Published online March 31, 2024
© 2024 The Microbiological Society of Korea.

Mi Jung Kim1 and Kyu-Jin Yum2*

1Coenbio Co., Ltd. R&D center, Seongnam 13207, Republic of Korea
2Coenbio Co., Ltd, Seongnam 13207, Republic of Korea
Correspondence to: *E-mail: ceb@coenbio.com;
Tel.: +82-31-776-2633; Fax: +82-31-776-2631

§Supplemental material for this article may be found at http://www.kjom.org/main.html
Received January 19, 2024; Revised March 6, 2024; Accepted March 13, 2024.
Abstract
Rynchosia nulubilis, also called rat-eye beans, has been widely used since ancient times as it has been known to promote hair growth, hair shine, and elasticity. In this study, we tried to develop a natural material good for human hair by fermenting rat-eye beans with specific kimchi lactobacilli. Leuconostoc holzapfelii is one of the dominant species in the early fermentation of kimchi. According to a recent study, this strain is involved in cell proliferation and cell cycle regulation of human hair follicle dermal papilla cells and has the potential to promote hair growth. Using a mixture of the small black bean powder fermented by L. brevis Ceb-kc-006 and the powder of L. holzapfelii Ceb-kc-003 purely separated from Korean kimchi, the proliferation of human hair dermal papilla cells and hair growth effects of the mixture were evaluated. When the content of L. holzapfelii Ceb-kc-003 in the mixture increased, human dermal papilla cell proliferation also increased by 61 ± 2.96% compared to the control. When the genes VEGF and FGF7, which are promoters of hair growth, were compared with controls, the expression level increased 68.83 ± 23.10% and 28.96 ± 6.02%, respectively. Furthermore, the Wnt3 gene increased by 61.81 ± 14.79% compared to the control. The hair growth inhibitors IL-1b and IL-6 genes decreased by 40.76 ± 15.65% and 61.17 ± 14.25% compared to the control, and TGF-β decreased by 7.88 ± 25.38%. Based on the gene expression results for hair growth and inhibition-related factors, it was found that the mixed extract had a positive effect on hair growth and hair loss inhibition.
Keywords : Lactobacillus brevis, Leuconostoc holzapfelii, Rynchosia nulubilis, hair growth, human dermal papilla cell (HDPC)
Body

인간의 모발은 두개골 보호와 같은 본래의 기능 이외에도 미용적인 면에서 큰 기능을 하고 있어 발모, 양모 및 탈모 예방은 예로부터 많은 관심의 대상이 되고 있다(Stenn, 1991; Hwang et al., 2017). 탈모는 크게 두 종류로 구분하며 휴지기의 모발이 자연스럽게 모낭에서 탈락되는 자연탈모와 임신, 유전적 요인, 호르몬 분비 이상, 노화, 극심한 다이어트, 정신적 스트레스, 불규칙한 식사 및 생활, 발열성 질병, 과도한 화학제품의 사용 등이 원인이 되는 비정상적인 탈모로 분류한다(Song and Mo, 2010; Lee et al., 2014). 과거에 탈모는 중장년층만의 문제로 생각되었지만 현재에는 20, 30대 젊은 층에서 크게 증가하는 추세이며 질병으로써 치부되고 있다(Ali and Martin, 2010; Wosicka and Cal, 2010). 이러한 증가로 인해 탈모 억제나 치료제, 발모에 대한 연구들 또한 증가하고 있다(Park et al., 2017; Jang et al., 2018; Chio and Jeong, 2021).

서목태(鼠目太) (Rhynchosia nulubilis)는 콩과에 속하는 다년초로 쥐눈이콩 또는 약콩이라고도 불리며, 다량의 단백질, 이소플라본(isoflavone), 레시틴(lecithin), 안토시아닌(anthocyanin), 사포닌(saponin) 등이 함유되어 있고, 신장질환, 심장질환, 골질환, 노인성질환 등에 예방 효능이 있어 예로부터 널리 이용되어 왔다(Shin and Joo, 2017; Kim and Kim, 2018; Lee and Park, 2021). 또한, 서목태는 오래전부터 모발 성장 및 윤기 탄력 증진에 관여하여 모발 건강을 촉진시킨다고 알려져 있다(Lee and Kim, 2005; Choi et al., 2017; Kim and Kim, 2018; Sung and Kim, 2022).

발효는 유산균(probiotics)이 당질을 이용하여 알코올, 유기산, 이산화탄소 등을 생성하는 과정들로써, 큰 분자의 영양소를 작은 분자로 분해함으로써 장에서 소화 흡수를 돕고, 식중독균 같은 및 병원균들의 성장을 억제하며, 식품의 건강기능성을 증가시킨다(Park, 2012; Choi et al., 2017; Shin, 2020). 유산균을 이용한 발효물은 발효유, 치즈와 같은 형태의 발효식품 또는 김치, 장류 같은 전통발효식품으로 제품화되는 것이 대부분이다. 따라서 식품원료 미생물로 기 등록되어 있는 유산균인 Lactobacillus brevis로 모발 건강에 좋은 서목태를 발효하는 것은 새로운 천연소재 개발 방법으로 모발 건강 관련 식품산업에 긍정적인 영향을 줄 수 있다.

Leuconostoc holzapfelii는 2007년에 에티오피아산 발효 커피에서 세계 최초로 순수 분리 동정된 균종이며(De Bruyne et al., 2007), 국내산 김치의 발효 초기나 젓갈 발효 시에 우세한 종균으로 확인된다(Jeong et al., 2013; Jung et al., 2013; Lee et al., 2015). 최근 연구에 따르면 이 균주는 인간 모낭 모유두세포[Human hair follicle dermal papilla cells (HFDPCs)]의 세포 증식과 세포주기 조절에 관여하며, Wnt/β-catenin 신호 전달 경로를 통한 조절을 통해 모발 성장 촉진 가능성이 보고되었다(Yoon et al., 2022). 이러한 L. holzapfelii는 본 사에서 2016년에 세계 최초로 한국 토종 김치에서 순수 분리하여 그 해 4월에 국제특허용으로 균주 기탁하였으며 L. holzapfelii Ceb-kc-003으로 명명하였다. 또한 본 사가 한국 토종 김치에서 순수 분리한 L. brevis Ceb-kc-006으로 발효한 서목태분말과 본 사 특허등록 균주인 L. holzapfelii Ceb-kc-003 혼합 시 두 소재 간의 상승효과로 인해 모발 건강 및 모발 성장에 영향을 미칠 것으로 판단되어 인간 모유두세포를 이용한 연구를 진행하였다.

이에 본 연구에서는 서목태분말에 L. brevis Ceb-kc-006을 이용하여 발효시킨 발효분말에 김치 유래 L. holzapfelii Ceb-kc-003을 첨가한 복합물의 추출물인 발효 서목태 유산균 복합 추출물이 인간 모유두세포 성장에 미치는 효과를 비교 분석함으로써 발모 촉진 및 탈모 예방을 위한 모발건강 신소재로서의 가능성을 살펴보고자 하였다.

재료 및 방법

균주 분리․동정

본 실험에 사용된 L. brevis Ceb-kc-006, L. holzapfelii Ceb-kc-003 균주는 충청도 천안시 소재 가정에서 담근 배추김치 시료에서 순수 분리하였다. 배추김치 시료를 단계별로 희석하여 MRS 배지에 30~37℃, 48시간 배양하여 집락을 분리하였다. 이렇게 분리․동정된 균주를 한국미생물보존센터에 기탁하였다. 배추김치로부터 분리․동정한 유산균에 대한 설명은 Table 1과 같다.

Information of strains used in the experiment

Lactobacillus brevis Ceb-kc-006
KCCM No. KCCM12126P
Oxygen tolerance facultative anaerobes
Temperature (°C) 35
Leuconostoc holzapfelii Ceb-kc-003
KCCM No. KCCM11830P
Oxygen tolerance facultative anaerobes
Temperature (°C) 30


이소플라본 배당체/비배당체 분석

서목태분말을 L. brevis Ceb-kc-006으로 발효 배양 후 이소플라본의 배당체/비배당체 함량을 비교하기 위하여, 서목태분말과 서목태발효분말을 한국기능식품연구원에 건강기능식품공전 ▶제4. 건강기능식품 시험법 ▶3. 개별성분별 시험법 ▶3-54 대두이소플라본 ▶3-53-1 이소플라본(제1법)으로 분석 의뢰하였다.

혼합추출물 제조

실험에 사용한 서목태분말은 쌀아지매(예천, 대한민국)에서 구입하였다. 서목태분말의 발효 및 추출물 제조는 Fig. 1에 도식화하였으며 다음과 같다. 서목태분말을 L. brevis Ceb-kc-006으로 35℃에서 72시간 발효 배양 후 동결건조 과정을 거쳐 분말화하여, L. brevis의 대사산물과 이소플라본의 비배당체가 포함된 분말을 얻었다. 여기에 L. holzapfelii Ceb-kc-003 균주가 99:1의 비율이 되도록 혼합하였다. 이 복합물에 dimethyl sulfoxide (DMSO)를 첨가하여 초음파추출기(Branson)를 사용하여 25℃에서 40 KHz의 초음파로 10분 추출하였다. 추출 후 13,000 rpm에서 30초 원심분리하여 상층액만 실험에 사용하였다.

Fig. 1. A flow diagram of DMSO-sonication extract preparation from fermented Rhynchosia nulubilis

인간 모유두세포 배양

인간 모유두세포[Human dermal papilla cell (HDPC)]는 ㈜세포바이오(CEFO)로부터 구입하여 사용하였다. ㈜세포바이오의 CEFOgroTM human dermal papilla growth medium을 성장배지로 사용하였고, 37℃, 5% CO2가 유지되는 세포배양기(Thermo Scientific)에서 배양하였다. 업체에서 제공한 프로토콜을 준수하여 계대 번호 8 이전 인간 모유두세포로 모든 실험을 수행하였다.

세포 독성 평가

혼합추출물을 농도별로 처리하였을 때 인간 모유두세포의 증식과 독성 여부를 확인하기 위하여 MTT assay (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide assay)를 실시하였다(Mosmann, 1983). 인간 모유두세포를 96 well-plate에 1 × 104 cells/well의 농도로 분주하여 24시간 배양한 뒤 혼합추출물 2, 4, 8, 10 μg/μl과 대조군(PBS)을 처리한 후 37℃, 5% CO2하에서 72시간 배양하였다. 배양 후 0.5 mg/ml thiazolyl blue tetrazolium bromide (MTT; Sigma) 용액을 넣어 4시간, 37℃에서 반응시킨 뒤 상층액을 제거하고 형성된 formazan을 dimethyl sulfoxide 100 μl로 녹여 ELISA reader (BioTek)로 540 nm에서 흡광도를 측정하였다. 세포의 생존율(%)은 [(실험군 OD값 ÷ 대조군 OD값) × 100]에 따라 산출하였다.

RNA 추출 및 Real-time PCR

인간 모유두세포를 1 × 104 cells/well의 농도로 6 well-plate에 24시간 배양한 후, 각 well에 혼합추출물 2 μg/μl과 대조군(PBS)를 처리하고 72시간 배양 후 배지를 제거한 다음 MiniBEST Universal RNA Extraction Kit (TaKaRa Bio Inc.)를 사용하여 RNA를 추출하였다. 추출한 RNA를 주형으로 One step TB Green® PrimeScriptTM plus RT-PCR kit (TaKaRa Bio Inc.)와 CronoSTARTM 96 Real-Time PCR System (TaKaRa Bio Inc.)장비를 사용하여 real-time PCR를 수행하였다(Arita et al., 2008). Real-time PCR은 1) reverse transcription (42℃, 5분, 95℃, 10초), 2) PCR reaction (95℃, 5초, 60℃ 30초), 3) dissociation (60℃, 30초, 95℃, 15초)의 3단계 PCR을 진행하고 2) PCR reaction 구간은 40회 반복하였으며, 각 유전자의 발현은 β-actin의 발현량으로 표준화하여 비교 분석하였다. 실험에 사용한 primer sequence는 Table 2와 같다.

Primer sequence for real-time PCR

Target gene Sequence
β-actin F catgtacgttgctatccaggc
R ctccttaatgtcacgcacgat
FGF7 F atcaggacagtggcagttgga
Fibroblast growth factor R aacatttcccctccgttgtg
IL-1b F ccacagaccttccaggagaatg
Interleukin-1b R gtgcagttcagtgatcgtacagg
IL-6 F actcacctcttcagaacgaattg
Interleukin-6 R ccatctttggaaggttcaggttg
TGF-β F gcttctccttgctgcgtgtc
Transforming growth factor-β R tcatcgttgtcgtcgtcatcac
VEFG F ttgccttgctgctctacctcca
Vascular endothelial growth factor R gatggcagtagctgcgctgata
Wnt3 F cctcaaggacaagtacgaca
R ggcaccttgaagtaggtgta


통계분석

각 실험은 3회 이상 반복실험을 통하여 결과를 얻었고, 실험결과는 SPSS Statistics (Ver.18, IBM)을 사용하여 평균 ± 표준편차(mean ± SD)로 표기하였고, 통계분석은 Student’s t-test로 분석하였으며 P-value값을 계산하여 통계적 유의성 검정을 실시하였다. P < 0.05인 경우 *로 표기하였고 P < 0.01인 경우 **로 표기하여 유의성을 나타내었다.

결 과

이소플라본의 배당체/비배당체 함량 분석

서목태분말을 L. brevis Ceb-kc-006으로 35℃, 72시간 발효 배양하여, 발효 유무에 따른 이소플라본의 배당체/비배당체 함량 분석을 진행하였다. 이소플라본의 배당체/비배당체 분석은 한국기능식품연구원에 의뢰하였다. 이소플라본은 화학적구조에 따라 배당체(genistin, daidzin, glycitin)와 비배당체(genistein, daidzein, glycitein)로 구분되며, 비발효식품에는 대부분 배당체로 존재한다. 배당체는 당과 결합된 형태로 장내 미생물이 분비하는 β-glucosidase 효소에 의해 비배당체로 변환되어 장 내 흡수된다. 또한, 균주를 사용하여 발효 시 대두이소플라본은 균주 혹은 균주의 대사산물에 의해서 배당체가 비배당체로 전환된다. 생서목태분말을 L. brevis Ceb-kc-006으로 발효 시 이소플라본의 배당체/비배당체 함량 변화를 Table 3에 정리하였다. 총 이소플라본 양은 71 mg/100 g으로 발효시키지 않은 서목태분말 대비 약 2.5배 증가하였고, 비배당체인 genistein도 16.5배 증가하였다. Genistein은 항산화, 항염증 뿐만 아니라 피부노화를 지연시키거나 모낭 세포의 주기 조절, 모발 성장에 관여한다고 알려져 있다(Liu et al., 2020; Sharifi-Rad et al., 2021; Jang and Yu, 2022). 따라서 발효서목태분말의 genistein 함량 증가는 모발 성장 및 탈모 예방에 도움이 될 것으로 판단된다.

Analysis of Isoflavone in Rhynchosia nulubilis with/without fermentation

Specimen Total isoflavone (mg/100 g) Glycoside and aglycone (mg/100 g)
Genistin Daidzin Glycitin
Genistein Daidzein Glycitein
Rhynchosia nulubilis 28 11 13 2
2 ‒ ‒
Fermented 71 2 27 ‒
Rhynchosia nulubilis 33 9 ‒


복합추출물이 모유두세포 증식 및 독성에 미치는 영향

서목태분말을 L. brevis Ceb-kc-006으로 발효시킨 발효서목태분말에 L. holzapfelii Ceb-kc-003 균주를 혼합하여 DMSO 추출한 복합추출물을 2, 4, 8, 10 μg/μl 농도로 72시간 배양 시 인간 모유두세포의 세포독성, 세포생존율에 미치는 영향은 Fig. 2와 같다. 4가지 농도 모두 대조군과 유사한 세포 생존율을 보였으며, 그 중 2 μg/μl 농도에서 세포 생존율이 대조군보다 22.56 ± 1.79% 증가하였다. 나머지 4, 8, 10 μg/μl 농도들은 대조군보다 증가하는 양상이 관찰되었다(15.56 ± 1.82%, 9.62 ± 2.87%, 14.98 ± 2.25%; not signification). 각각의 농도에서 세포 생존율이 대조군 대비 증가하는 것은 세포증식으로 인한 결과로 유추할 수 있다. 본 사의 복합추출물 처리 시 세포증식이 유도되는 것은 선행연구에서도 관찰되었으며, 복합추출물의 L. holzapfelii Ceb-kc-003의 함량 증가 시 세포증식도 대조군 대비 61 ± 2.96% 증가함을 확인하였다(Supplementary data Fig. S1). 따라서 L. holzapfelii Ceb-kc-003이 인간 모유두세포 증식에 중요한 역할을 할 것으로 사료된다. 또한, 각각의 농도에서 세포독성은 관찰되지 않았다. 이러한 결과로 복합추출물이 인간 모유두세포의 세포 생존율에 영향을 미치지 않으며, 특이적인 독성도 존재하지 않음을 확인하였다. 따라서, 본 실험에서는 4 개의 농도 중 인간 모유두세포의 성장에 긍정적인 영향을 주는 것으로 관찰된 2 μg/μl의 농도를 사용하여 실험을 수행하였다.

Fig. 2. Effects of DMSO-sonication extracts from fermented Rhynchosia nulubilis on the cell viability of HDPCs. Cell viability was measured by MTT assay. Values represent the mean ± SD of five independent experiments. An asterisk indicates a significant difference compared to the control group (Student’s t-test, *P < 0.05).

모발 성장 촉진 인자 유전자 발현 증가효과

모발의 성장은 모유두세포와 모발 성장 촉진․억제 인자의 상호작용을 통해 세포의 증식, 분열, 사멸 등을 조절하여 이루어지며, 모발 성장주기 중 휴지기가 되면 모발 성장을 위해 다양한 사이토카인(cytokine)과 모발 성장인자들이 분비된다. 모발성장촉진인자로는 혈관 내피 성장 및 혈관 확장에 관여하며 혈액순환을 개선하여 모발의 성장과 모근세포의 분화를 유도시키는 혈관내피성장인자인 VEGF (vascular endothelial growth factor)와 모발 성장을 자극하여 성장기를 유도하는 섬유아세포성장인자인 FGF (fibroblast growth factor)가 있다. 그리고, 모발성장, 모발재생, 모낭 줄기세포의 활성화 및 hair germ cell의 증식 등에 중요한 역할을 하는 신호전달 기전으로는 Wnt/β-catenin pathway가 있다.

인간 모유두세포에 2 μg/μl 복합추출물을 72시간 처리한 후 VEGF, FGF7, Wnt3 유전자 발현 양상을 관찰하였다(Fig. 3). VEGF와 FGF7 유전자를 대조군과 비교하였을 때, 그 발현량이 각각 68.83 ± 23.10%, 28.96 ± 6.02% 증가하였다. Wnt3 유전자는 대조군보다 61.81 ± 14.79% 증가함을 확인하였다. VEGF, FGF, Wnt3 발현량 증가 결과를 볼 때 복합추출물이 모발 성장에 긍정적인 영향을 미칠 것으로 판단된다.

Fig. 3. Effects of DMSO-sonication extracts from fermented Rhynchosia nulubilis on the gene expression of growth factor. Expression of growth factors (VEGF, FGF7, Wnt3) were analyzed by real-time PCR. VEGF, vascular endothelial growth factor; FGF7, fibroblast growth factor; Wnt3, Wnt family. Values represent the mean ± SD of five independent experiments. An asterisk indicates a significant difference compared to the control group (Student’s t-test, *P < 0.05, **P < 0.01).

모발 성장 억제 유전자 발현 감소효과

TGF-β (transforming growth factor-beta)는 외측근모초(outer root sheath)에서 생성되어 정상적인 모낭의 성장기를 조기에 퇴행기로 촉진시키는 모발 성장 억제 인자이며(Zhang et al., 2018), IL-1, 6 (interleukin-1, 6) 또한 외측근모초 세포에 존재하며, 모낭에서 모낭 성장을 억제하는 것으로 알려져 있다(Hoffmann et al., 1996; Hibino and Nishiyama, 2004; Kwack et al., 2012).

IL-1b, IL-6 유전자는 대조군과 비교 시 40.76 ± 15.65%, 61.17 ± 14.25% 감소하였으며, TGF-β의 경우 7.88 ± 25.38% 감소하였으나 유의성은 없었다(Fig. 4). 모발 성장 억제 인자인 TGF-β은 감소하는 경향을 보였으며 IL-1b, IL-6는 유의성 있게 감소하였으므로, 복합추출물이 모발 세포의 퇴화를 방지하여 탈모 유도를 억제할 것으로 사료된다.

Fig. 4. Effects of DMSO-sonication extracts from fermented Rhynchosia nulubilis on the gene expression of inhibitory factor. Expression of inhibitory factors (TGF-β, IL-1b, IL-6) were analyzed by real-time PCR. TGF-β, transforming growth factor beta 1; IL-1b, Interleukin-1b; IL-6, Interleukin-6. Values represent the mean ± SD of six independent experiments. An asterisk indicates a significant difference compared to the control group (Student’s t-test, *P < 0.05).
고 찰

서목태는 천연물로서 예로부터 질병에 대한 치료 및 예방 목적으로 사용됐으며(Kim and Song, 2012), 최근 모발 성장 관련 연구도 이루어지고 있다. 우리는 천연물인 서목태분말을 식품 미생물원료인 L. brevis Ceb-kc-006으로 발효하여 식품으로서의 안정성과 이소플라본의 비배당체 및 유용 대사산물을 확보하였다. 발효서목태분말에 본 사의 특허 균주인 L. holzapfelii Ceb-kc-003을 혼합하여 모발 건강과 성장에 특화된 천연소재를 개발하고자 하였다. 이에 본 연구에서는 발효 서목태 유산균 복합물을 DMSO로 추출하여 모발 성장 소재로서의 가능성을 확인하였다.

먼저, 생서목태분말을 L. brevis Ceb-kc-006으로 발효 배양 시 genistein 함량이 약 16.5배 증가하였다. Genistein은 비배당체로서 인체내 소화 흡수가 용이하고 모발 성장에 관여하므로, 발효서목태분말이 모발건강에 긍정적 효과를 줄 것으로 판단되었다.

서목태발효분말에 L. holzapfelii Ceb-kc-003을 혼합하여 DMSO 추출한 복합추출물로 인간 모유두세포에서의 세포 독성을 확인하였을 때, 2, 4, 8, 10 μg/μl 농도 범위 내에서 유의적인 세포 독성은 관찰되지 않았으며, 2 μg/μl 농도 처리 시 대조군 대비 22.56 ± 1.79%의 세포증식 효과를 나타내었다. 그리고 모발 건강 관련 효과를 분석하기 위하여 모발 성장 촉진․억제 인자들의 발현을 관찰하였다.

VEGF, FGF 등의 성장인자들은 여러 실험을 통하여 모낭의 특정 장소에 작용하여 모발성장에 관여한다고 이미 밝혀진 바 있다(Tsuboi et al., 1993; Tsuboi, 1997; Ozeki and Tabata, 2003; Sun et al., 2018). 그 중 VEGF는 모낭의 성장 과정에서 혈관 생성에 관여하는 중요한 인자로 알려져 있을 뿐만 아니라, 여러 동물실험에서 혈관 생성과 탈모 후 자라나는 모발의 크기를 증가시키고 성장 속도를 촉진시킨다는 보고가 있다(Yano et al., 2001). 인간 모유두세포에서 혼합추출물을 처리하여 VEGF 발현을 확인하였을 때 68.83 ± 23.10% 증가하여 모발 성장 촉진 효과를 확인하였다.

Lin et al. (2015)은 FGF를 모발 성장을 촉진시키는 주변 분비 성장인자(paracrine growth factor)라고 보고하였으며, 모발의 성장을 촉진하고 모발 세포의 퇴화를 방지하여 탈모를 방지한다고 하였다. Wnt는 β-catenin signaling을 활성화하여 모발성장, 모발재생, 모낭 줄기세포의 활성화 및 hair germ cell의 증식 등에 중요한 역할을 한다(Ito et al., 2007; Ouji et al., 2007; Greco et al., 2009). Wnt family 중에서 Wnt3는 모발주기와 재생 및 모유두세포 증식에 관여한다(Kishimoto et al., 2000; Choi, 2020; Wang et al., 2022). 이러한 Wnt/β-catenin pathway는 Wnt외에도 다른 성장인자, 수용체 신호전달과 같은 다른 요인에 의해서도 조절된다(Lin et al., 2015; Kiratipaiboon et al., 2016; Lee et al., 2016). FGF는 휴지기가 형성된 C57BL/6 마우스에서 성장기의 조기 발현과 성장기 단계를 유지시켜 모발 성장을 향상시켰으며, β-catenin의 전사를 유도하였다(Lin et al., 2015). 그러므로 FGF와 Wnt3의 발현의 증가는 Wnt/β- catenin pathway를 활성화시켜 모발성장에 긍정적인 효과를 줄 것으로 판단된다. 본 실험 결과에서도 FGF와 Wnt3의 발현이 대조군 대비 각각 28.96 ± 6.02%, 61.81 ± 14.79% 증가함으로써, 모발성장 촉진 효과를 확인하였다. 이러한 결과를 통하여 복합추출물은 모발성장촉진인자들의 발현을 증가시켜, 모발성장에 긍정적인 영향을 주는 것으로 관측되며, 모발성장 기전으로는 Wnt/β-catenin pathway가 관여할 것으로 사료되나, 보다 자세한 기전에 관하여서는 추후 연구가 더 필요하다.

TGF-β은 모낭의 발달과 성숙을 방해하고 모발의 퇴화기를 촉진시키는 역할을 하며, 그 전사량(transcript level)은 모발성장 주기에서 성장기 동안 감소하고 성장기에서 퇴화기로 넘어갈 때 최대가 된다(Seiberg et al., 1995; Tang et al., 2003). 본 연구에서 TGF-β의 발현량은 대조군과 비교하였을 때, 7.88 ± 25.38% 감소하는 양상이 관찰되었다. 이 발현량 결과는 본 연구에 사용된 복합추출물에 의해서 모발의 성장기에서 퇴화기로 넘어가는 과정이 늦어지고 있음을 유추할 수 있다.

IL-1과 IL-6는 항염증 관련 바이오마커로서, 모낭 성장을 억제하는 것으로 알려져 있다. IL-1, IL-6는 대조군보다 발현량이 40.76 ± 15.65%, 61.17 ± 14.25% 각각 감소하였다. 연골세포에서 TGF-β는 염증반응에서 분비되는 사이토카인의 활성을 억제 시키는데 대표적인 것으로 IL-1이 있다(Harvey et al., 1991; Park et al., 1997). 모유두세포에서 IL-1 발현 감소의 원인은 두 가지로 추측될 수 있다. 1) 복합추출물에 의한 염증반응 억제 영향 2) TGF-β에 의한 간접적인 영향으로 이 부분에 관해서는 연구가 더 필요하다.

따라서 본 연구의 모발성장 및 억제 관련 인자들에 대한 유전자 발현 결과들을 볼 때 L. brevis Ceb-kc-006으로 발효시킨 후 본 사 특허 균주인 L. holzapfelii Ceb-kc-003을 혼합하여 DMSO 추출한 복합추출물은 모발 성장 및 탈모 억제에 긍정적인 영향을 줄 것으로 판단된다.

적 요

쥐눈이콩 또는 약콩이라 불리는 서목태(Rynchosia nulubilis)는 예로부터 모발 성장, 모발 윤기, 탄력 촉진에 관여하여 모발 건강에 널리 사용되어 왔다. 본 연구에서는 서목태분말을 특정 김치유산균으로 발효시킨 발효물에 신균주를 혼합하여 사람의 모발 건강에 좋은 천연물질을 개발하고자 하였다. Lactobacillus brevis는 식품원료로 식품의약품안전처가 고시한 GRAS (Generally recognized as safe) 유산균으로서, 전통발효식품에 주로 사용되는 식품 미생물원료이다. Leuconostoc holzapfelii는 김치의 초기 발효에서 중요한 종균 중 하나로 최근 연구에 따르면, 인간 모낭 모유두세포에서 세포증식 및 세포주기 조절에 관여하여 모발 성장 촉진 가능성이 보고되었다. 본 연구에서는 L. brevis Ceb-kc-006에 의해 발효된 서목태분말과 한국산 김치에서 순수 분리된 L. holzapfelii Ceb-kc-003 균주를 혼합하고 DMSO를 사용하여 추출한 발효 서목태 유산균 복합 추출물을 이용하여 인간 모유두세포 증식 및 모발 성장 촉진 효과를 관찰하였다. 발효 서목태 유산균 복합 추출물의 L. holzapfelii Ceb-kc-003 함량이 증가함에 따라 인간 모유두세포 증식도 증가하였다(61 ± 2.96%, P < 0.001). 모발성장촉진 유전자인 VEGF와 FGF7 유전자를 대조군과 비교했을 때, 각각 68.83 ± 23.10%, 28.96 ± 6.02% 발현이 증가하였고, Wnt3 유전자는 대조군 대비 61.81 ± 14.79% 증가한 것으로 관찰되었다. 모발성장억제 인자인 IL-1b 및 IL-6 유전자는 대조군에 비해 40.76 ± 15.65%, 61.17 ± 14.25% 감소하였고, TGF-β는 7.88 ± 25.38% 감소하는 양상을 보였다. 따라서 본 연구의 모발성장 및 억제 관련 인자들에 대한 유전자 발현 결과들을 바탕으로, 발효 서목태 유산균 복합 추출물이 모발 성장 및 탈모 억제에 긍정적인 영향을 미칠 것으로 판단된다.

Acknowledgments

이 논문은 주식회사 코엔바이오의 연구비 지원과 균주 제공에 의해 연구되었습니다.

Conflict of Interest

염규진은 주식회사 코엔바이오의 대표이고, 김미정은 주식회사 코엔바이오 산하 기술연구소의 직원입니다. 본 논문의 저자는 연구가 잠재적인 이해 상충으로 해석될 수 있는 상업적 또는 재정적 관계없이 수행되었음을 밝힙니다.

References
  1. Ali A and Martin IV. 2010. Hair growth in patients alopecia areata totalis after treatment with simvastatin and ezetimibe. J. Drugs Dermatol. 9, 62-64.
  2. Arita M, Wakita T, and Shimizu H. 2008. Characterization of pharmacologically active compounds that inhibit poliovirus and enterovirus 71 infectivity. J. Gen. Virol. 89, 2518-2530.
    Pubmed CrossRef
  3. Chio HC and Jeong NH. 2021. Effect of Saussurea Lappa root extract on proliferation and hair growth-related signal pathway in human hair follicle dermal papilla cells. Appl. Chem. Eng. 32, 647-652.
  4. Choi BY. 2020. Targeting wnt/β-catenin pathway for developing therapies for hair loss. Int. J. Mol. Sci. 21, 4915.
    Pubmed KoreaMed CrossRef
  5. Choi JH, Lee M, Kim HJ, Kwon JI, and Lee Y. 2017. Effects of black soybean and fermented black soybean extracts on proliferation of human follicle dermal papilla cells. J. Korean Soc. Food Sci. Nutr. 46, 671-680.
  6. De Bruyne K, Schillinger U, Caroline L, Boehringer B, Cleenwerck I, Vancanneyt M, De Vuyst L, Franz C, and Vandamme P. 2007. Leuconostoc holzapfelii sp. nov., isolated from Ethiopian coffee fermentation and assessment of sequence analysis of housekeeping genes from delineation of Leuconostoc species. Int. J. Syst. Evol. Microbiol. 57, 2952-2959.
    Pubmed CrossRef
  7. Greco V, Chen T, Rendl M, Schober M, Pasolli HA, Stokes N, Dela Cruz-Racelis J, and Fuchs E. 2009. A two-step mechanism for stem cell activation during hair regeneration. Cell Stem Cell. 4, 155-169.
    Pubmed KoreaMed CrossRef
  8. Harvey AK, Hrubey PS, and Chandrasekhae S. 1991. Transforming growth factor-beta inhibition of interleukin-1 activity involves down-regulation of interleukin-1 receptors on chondrocytes. Exp. Cell Res. 195, 376-385.
    Pubmed CrossRef
  9. Hibino T and Nishiyama T. 2004. Role of TGF-β2 in the human hair cycle. J. Dermatol. Sci. 35, 9-18.
  10. Hoffmann R, Eicheler W, Huth A, Wenzel E, and Happle R. 1996. Cytokines and growth factors influence hair growth in vitro. Possible implications for the pathogenesis and treatment of alopecia areata. Arch. Dermatol. Res. 288, 153-153.
    Pubmed CrossRef
  11. Hwang HS, Hwang TH, Pyo AJ, and Ju EH. 2017. Anti-oxidant efficacy and effects on expression of growth factors in human hair follicle dermal papilla cells of Rosa multiflora root extracts. Asian J. Beauty Cosmetol. 15, 146-158.
    CrossRef
  12. Ito M, Yang Z, Andl T, Cui C, Kim N, Millar SE, and Cotsarelis G. 2007. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 447, 316-320.
    Pubmed CrossRef
  13. Jang SH, Kim MJ, Wee JH, Kim JT, and Choi WH. 2018. Effects of amla (Phyllanthus embilica L.) extract on hair growth promoting. KSBB J. 33, 299-305.
    CrossRef
  14. Jang EJ and Yu EM. 2022. Effect of genistein on the hair cycle-related genes in skin of DNCB-induced dermatitis mice. J. Invest. Cosmetol. 18, 155-160.
  15. Jeong SH, Lee SH, Jung JY, Choi EJ, and Jeon CO. 2013. Microbial succession and metabolite changes during long-term storage of Kimchi. J. Food Sci. 78, 763-769.
    CrossRef
  16. Jung J, Choi S, Jeon CO, and Park W. 2013. Pyrosequencing-based analysis of the bacterial community in Korean traditional seafood, Ojingeo jeotgal. J. Microbiol. Biotechnol. 23, 1428-1433.
    Pubmed CrossRef
  17. Kim JR and Kim MM. 2018. Effect of Rhynchosia nulubilis ethanolic extract on DOPA oxidation and melanin synthesis. J. Life Sci. 28, 331-338.
  18. Kim H and Song MJ. 2012. Traditional plant-based therapies for respiratory diseases found in North Jeolla Province, Korea. J. Altern. Complement. Med. 18, 287-293.
    Pubmed CrossRef
  19. Kiratipaiboon C, Tengamnuay P, and Chanvorachote P. 2016. Ciprofloxacin improves the stemness of human dermal papilla cells. Stem Cells Int. 2016, 5831276.
    Pubmed KoreaMed CrossRef
  20. Kishimoto J, Burgeson RE, and Morgan BA. 2000. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 14, 1181-1185.
    CrossRef
  21. Kwack MH, Ahn JS, Kim MK, Kim JC, and Sung YK. 2012. Dihydrotestosterone-inducible IL-6 inhibits elongation of human hair shafts by suppressing matrix cell proliferation and promotes regression of hair follicles in mice. J. Invest. Dermatol. 132, 43-49.
    Pubmed CrossRef
  22. Lee LS, Chio EJ, Kim CH, Kim YB, Kum JS, and Park JD. 2014. Quality characteristics and antioxidant properties of black and yellow soybeans. Korean J. Food Sci. Technol. 46, 757-761.
  23. Lee EY, Choi EJ, Kim JA, Hwang YL, Kim CD, Lee MH, Roh SS, Kim YH, Han IB, and Kang SJ. 2016. Malva verticillata seed extracts upregulate the Wnt pathway in human dermal papilla cells. Int. J. Cosmet. Sci. 38, 148-154.
    Pubmed CrossRef
  24. Lee SH, Jung JY, and Jeon CO. 2015. Source tracking and succession of kimchi lactic acid bacteria during fermentation. J. Food Sci. 80, M1871-M1877.
    CrossRef
  25. Lee CS and Kim HH. 2005. A study on the soybean effects for scalp hair treatment. J. Beau. Tricho. 1, 77-90.
  26. Lee HJ and Park HJ. 2021. Germinated Rhynchosia nulubilis fermented with Lactobacillus pentosus SC65 reduces particulate matter induced Type II alveolar epithelial apoptotic cell death. Int. J. Mol. Sci. 22, 3660.
    Pubmed KoreaMed CrossRef
  27. Lin W, Xiang LJ, Shi HX, Zhang J, Jiang L, Cai P, Lin ZL, Lin BB, Huang Y, and Zhang HZhang H, et al. 2015. Fibroblast growth factors stimulate hair growth through β-catenin and shh expression in C57BL/6 mice. BioMed Res. Int. 2015, 730139.
    Pubmed KoreaMed CrossRef
  28. Liu T, Li N, Yan Y, Liu Y, Xiong K, Liu Y, Xia Q, Zhang H, and Liu Z. 2020. Recent advances in the anti-aging effects of phytoestrogens on collagen, water content, and oxidative stress. Phyther. Res. 34, 435-447.
    Pubmed KoreaMed CrossRef
  29. Mosmann T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55-63.
    Pubmed CrossRef
  30. Ouji Y, Yoshikawa M, Moriya K, and Ishizaka S. 2007. Effects of Wnt-10b on hair shaft growth in hair follicle cultures. Biochem. Biophys. Res. Commun. 359, 516-522.
    Pubmed CrossRef
  31. Ozeki M and Tabata Y. 2003. In vivo promoted growth of mice hair follicles by the controlled release of growth factors. Biomaterials 24, 2387-2394.
    Pubmed CrossRef
  32. Park KY. 2012. Increased health functionality of fermented foods. Food Ind. Nutr. 17, 1-8.
  33. Park CW, Jang YH, Tae K, Kim SK, and Lee KC. 1997. Experimental study on TGF-β1 gene expression in cholesteatoma. Korean J. Otorhinolaryngol-Head Neck Surg. 40, 69-75.
  34. Park SA, Ko KS, In MH, Mun YJ, and Woo WH. 2017. Effect of Puerariae radix ethanol extract on the proliferation of human dermal papilla cells. J. Physiol. Pathol. Korean Med. 31, 167-172.
    CrossRef
  35. Seiberg M, Marthinuss J, and Stenn KS. 1995. Changes in expression of apoptosis-associated genes in skin mark early catagen. J. Invest. Dermatol. 104, 78-82.
    Pubmed CrossRef
  36. Sharifi-Rad J, Quispe C, Imran M, Rauf A, Nadeem M, Gondal T, Ahmad B, Atif M, Mubarak M, and Sytar OSytar O, et al. 2021. Genistein: an integrative overview of its mode of action, pharmacological properties, and health benefits. Oxid. Med. Cell. Longev. 2021, 3268136.
  37. Shin DH. 2020. Korean traditional fermented foods and their future approach. Food Sci. Ind. 53, 148-165.
  38. Shin JH and Joo NM. 2017. Inhibitory effects on human breast cancer cells migration of small black bean according to the cooking methods. Korean J. Food Nutr. 30, 728-734.
  39. Song MR and Mo JH. 2010. The effect of environment and genetic elements on women's alopecia. J. Korean Soc. Des. Cult. 16, 255-261.
  40. Stenn K. 1991. The molecular and structural biology of hair: introduction. Ann. N. Y. Acad. Sci. 642, 11-13.
  41. Sun S, Wang YC, Guo K, Du J, Zhou HJ, and Ren AJ. 2018. Finasteride inhibits microvascular density and VEGF expression in the seminal vesicle of rats. Zhonghua Nan Ke Xue 24, 387-392.
  42. Sung HY and Kim KH. 2022. Hair growth promotion with black soybean extracts: case series. J. Pharmacopuncture 25, 63-67.
    Pubmed KoreaMed CrossRef
  43. Tang L, Bernardo O, Bolduc C, Lui H, Madani S, and Shapiro J. 2003. The expression of insulin-like growth factor 1 in follicular dermal papillae correlates with therapeutic efficacy of finasteride in androgenetic alopecia. J. Am. Acad. Dermatol. 49, 229-233.
    Pubmed CrossRef
  44. Tsuboi R. 1997. Growth factors and hair growth. Korean J. Invest. Dermatol. 4, 103-108.
  45. Tsuboi R, Sato C, Kurita Y, Ron D, Rubin JS, and Ogawa H. 1993. Keratinocyte growth factor (FGF-7) stimulates migration and plasminogen activator activity of normal human keratinocytes. J. Invest. Dermatol. 101, 49-53.
    Pubmed CrossRef
  46. Wang X, Liu Y, He J, Wang J, Chen X, and Yang R. 2022. Regulation of signaling pathways in hair follicle stem cells. Burns Trauma 10, tkac022.
    Pubmed KoreaMed CrossRef
  47. Wosicka H and Cal K. 2010. Targeting to the hair follicles: current status and potential. J. Dermatol. Sci. 57, 83-89.
    Pubmed CrossRef
  48. Yano K, Brown LF, and Detmar M. 2001. Control of hair growth and follicle size by VEGF-mediated angiogenesis. J. Clin. Invest. 107, 409-417.
    Pubmed KoreaMed CrossRef
  49. Yoon YC, Ahn BH, Min JW, Lee KR, Park SH, and Kang HC. 2022. Stimulatory effects of extracellular vesicles derived from Leuconostoc holzapfelii that exists in human scalp on hair growth in human follicle dermal papilla cells. Curr. Issues Mol. Biol. 44, 845-866.
    Pubmed KoreaMed CrossRef
  50. Zhang D, Qin H, Leng Y, Li X, Zhang L, Bai D, Meng Y, and Wang J. 2018. LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF β1 and VEGF. Exp. Ther. Med. 16, 2337-2342.
    CrossRef

September 2024, 60 (3)
Full Text(PDF) Free
Supplementary File

Social Network Service
Services

Author ORCID Information