The excessive use and inappropriate administration of antibiotics during the antibiotic era have led to the rapid emergence of multidrug-resistant pathogens. Antimicrobial resistance raises morbidity, mortality, hospital stays, and healthcare expenses (García et al., 2023). Staphylococcus aureus (MRSA) and multidrug-resistant (MDR) Mycobacterium tuberculosis are major concerns among Gram-positive bacteria, while extended-spectrum beta-lactamase (ESBLs)-producing bacteria are a significant global healthcare issue among Gram-negative bacteria in the 21st century (Darbandi et al., 2022). The widespread use of antibiotics ensures that the spread and prevalence of these multidrug-resistant pathogens, as well as future emerging ones, will persist. It is challenging to reverse antimicrobial resistance and there is a critical need for new antimicrobials effective against these difficult-to-treat multidrug-resistant pathogens (Abdul-Husin et al., 2016). However, it is expected that antibiotic resistance will continue to develop faster than new treatment options become available, necessitating a deeper understanding of the molecular, evolutionary, and ecological mechanisms of antibiotic resistance spread (Deyno et al., 2017). To address the current antimicrobial resistance crisis, entirely new strategies must be developed to combat these pathogens, such as combining antimicrobial drugs with other agents that counteract antibiotic-resistant mechanisms. Additionally, a more personalized approach based on precise diagnostic tools will ensure prompt and targeted treatments, as many antibiotics are frequently prescribed inappropriately. Furthermore, better control is needed for the overall use and release of antibiotics into the environment (Medina and Pieper, 2016).

Colicin is a plasmid-borne colicin produced by a variety of Escherichia coli strains. E. coli produces colicins, which are a type of bacteriocin. These colicins eliminate non-host E. coli strains by creating pores in the inner membrane, stopping cell-wall synthesis, and breaking down nucleic acids (Cascales et al., 2007). Strains of E. coli that have a colicinogenic plasmid, pCol, produce colicins. These colicinogenic strains are commonly found in the intestines of animals and typically carry multiple plasmids, but only one specific colicinogenic plasmid. pCol is divided into two classes: type I and type II. Type I plasmids are small, ranging from 6 to 10 kb, and are present in around 20 copies per cell. They can be replicated and mobilized in the presence of a conjugative plasmid and mainly encode colicins of group A. These plasmids have been widely used in genetic engineering and biotechnology. On the other hand, type II pCol plasmids are large, single-copy plasmids of about 40 kb that usually encode colicins of group B (Riley et al., 1994). They are conjugative and facilitate the horizontal transfer of genetic material between cells by physical contact, similar to sexual factors. These large pCol plasmids may contain one or two colicin operons located adjacent to each other, allowing the cells carrying them to produce two different colicins, such as colicins B and D, B and M, and Ia and V. There are various plasmids that can carry the same colicin. The most well-known example is colicin E1, which is carried by type I plasmids such as pML30 and pJC411. Even though the sequence, organization of the plasmids, and amino acid compositions of their gene products differ, the encoded colicin shares the same characteristics: it is a pore-forming protein that uses BtuB as a receptor and the Tol system as transit machinery. It is important to establish a naming system for these plasmids, using either the name of the plasmid, such as colicin E1-ML30, or a letter, such as colicin E1a. This situation is not unique, as different plasmids also encode colicins A, E2, E3, B, and D (Cascales et al., 2007). Based on its mechanism of action, colicin is divided into three groups. Colicin E1 and E3, which are lethal to sensitive E. coli strains, act by degrading single strands of DNA. Colicin E2 and E6, which cause disc-shaped holes in the inner membrane of sensitive strains, are classified as group two colicins. Group three colicins, which consist of colicin E7 (a lectin colicin), have no currently known action that corresponds to the group (Braz et al., 2020). The species sensitivity to colicin depends mainly on the transport of colicin across the outer membrane and, to a lesser extent, on the transport across the inner membrane. It has been convincingly shown that E. coli K12-strains possess several of plasmid-mediated, temperature-dependent ability to produce colicin. Colicin therefore uses as an antibacterial against the pathogenic bacteria (Cameron et al., 2019).

Escherichia coli is a group of bacteria that lives in the intestines of healthy people and animals. Most strains of E. coli are harmless, but some can cause severe food poisoning in humans. Pathogenic strains of E. coli can cause diarrhea, urinary tract infections, respiratory illness, and pneumonia, as well as other illnesses. Escherichia coli is transmitted through contaminated water or food, or through contact with animals or persons (Cohen-Khait et al., 2021).

The antibiotic properties of colicins have been studied in different pathogenic strains of E. coli owing to the adverse effect on the pathogenic strains as well as non-pathogenic strains. Colicins, once released into the cell environment of a production strain, destructively interact with the target cells preventing nutrient uptake or functionally disrupting essential cellular processes (Widodo et al., 2023).

In additions colicins are produced by 25% of E. coli strains and act against related pathogenic bacteria of the same species. Colicins target a spectrum of cell envelope components that are exploited for uptake, including outer membrane receptors and transporters along with periplasmic transport systems associated with the inner membrane (Chikindas et al., 2018). Moreover, colicins can exploit the inner membrane pathway to permeabilize their target cells, leading to inhibition of DNA and RNA synthesis, as well as protein synthesis, which is pivotal to addressing the pathogenic strains in colonizing and infecting the host (Budiardjo et al., 2022). The emergence of resistance to third generation cephalosporin is linked to the production of β-lactamases, such as ESBL, AmpCs, and carbapenemases. The major β-lactamase genes include variations of CTX-M, SHV, TEM, VEB, GES, PER, TLA, and OXA, which have expanded the range of substances they can act against, including ceftazidime, cefotaxime, and ceftriaxone. These genes have a wide range of hosts but are primarily found in E. coli and Klebsiella spp. Meanwhile, OXA genes are predominantly found in Pseudomonas spp. and Acinetobacter spp. (Abrar et al., 2019). To contribute to finding alternative solutions to antibiotics and work on pathogenic bacterial inhibition using products of biological origin, in this research, we will study the production of colicin by different E. coli isolates and investigate the ability of colicin to inhibit or kill multidrug-resistant bacteria. As well as, gene expression variation of some virulence factors, blaTEM and blaOXA genes, of different isolates will study.

Sampling

Different clinical samples from different places were collected in sterilized swabs. Forty E. coli samples were collected from different sources for colicin production. For pathogenic isolates, thirty samples were obtained from urinary tract infection, 25 from wound injuries, and 20 from foot ulcer patients, for the ethical statement all the isolate were collected from the store cultures in the Microbiology Laboratory of the Department of Medical Biotechnology at Al-Qasim Green University so there is no any direct contact with the patient. All isolated bacteria were diagnosed by phenotypic appearance and biochemical tests, in addition to confirming the diagnosis using Vitek2 Compact System.

Production of colicin

The method of producing colicin, which includes isolating and diagnosing the producing isolate, and the steps used in colicin overproduction and purification were according to Younas et al. (2022).

Isolation colicin- producing E. coli: the primary focus of the study is to select isolates that produce colicin. The isolates were examined using the agar-well technique, with either Mueller-Hinton agar or Neutron agar. The zones of inhibition were measured in millimeters. Different strains of E. coli and Klebsiella were employed as controls to assess bacteriocin production. In short, bacterial isolates (E. coli) were inoculated onto agar plates using the McFarland method in sterile conditions, and 100 µl of test samples were added to 8 mm diameter holes, followed by an incubation at 37ºC for 24 h. Following the incubation period, the diameter of the inhibition zones was recorded.

Colicin overproduction: colicin-producing bacteria were expanded and activated by introducing 20 ml of E. coli from Brain Heart Broth into 1 L of Brain Heart Broth prepared under sterile conditions, followed by the addition of 0.001 mg of mitomycin-C to induce colicin production in the bacteria. The prepared solution was placed in a shaking incubator to ensure proper aeration at 37ºC for 48 h. Following the incubation period, the solution was centrifuged at a speed of 14,000 rpm for 15 min to separate the sediment from the filtrate, which was then stored at refrigeration temperature.

Extraction and purification of colicin: ammonium sulfate was used to extract and precipitate colicin to 70% saturation at 0–4°C. Then, a refrigerated centrifuge was used at 3000 rpm to obtain the residue. To ensure that the complete sample was obtained, this process was repeated twice. Dialysis was used after precipitation of colicin to remove contaminants such as salts and small particles, and then ultrafiltration with a size ranging from 50–100 Daltons was used to ensure that there was no other protein in the sample. Finally, SDS-polyacrylamide electrophoresis was used to determine the molecular weight and purity of the extracted colicin as shown in Fig. 1.

Fig. 1. A stained polyacrylamide gel summarizing the purification of a colicin. A coomassie-stained SDS polyacrylamide gel analyzing the purification of the protein is shown. Lanes: 1, a molecular weight marker, with 7 bands of known size (ranging from 14.4 to 116 kDa); 2, present the colicin expression and purification procedure for this protein. The figure showed the molecular size comparing with the stander molecular weight.

Antibacterial activity estimation of colicin

The antibacterial activity of colicin was assessed using a serial dilution which is identical to the minimum inhibitory concentration (MIC) technique for evaluating antibiotics (Mayr-Harting et al., 1972). This procedure involves a series of dilutions of colicin produced by E. coli and then applying it to several different pathogenic isolates using the McFarland method on Mueller Hinton agar plates. To perform this test, sterile petri dishes were filled with 250 ml of Mueller Hinton agar medium and the bacterial sample was spread evenly on the plate using a sterile cotton swab. Wells of 6 mm diameter were created in the agar for each of the concentrations―62, 125, 250, 500 and 1000 µg/ml, and one well was reserved for the control group (D.W as the control) using a cork borer. The plates were then incubated for 24 h at 36 ± 1°C under aerobic conditions, leading to the observation of confluent bacterial growth after incubation. The inhibition of bacterial growth was indicated in millimeters. A time-kill kinetics test was employed to evaluate the effect of colicin exposure in the cultures. For the test, new cultures were grown in colicin-containing medium, while for the control; other cultures were grown without the addition of colicin. The biggest dilution creates an inhibition zone indicating the force of colicin activity. Thus, colicin activity is proportional to the reciprocal of the highest dilution factor that produces a detectable zone of inhibition. The MIC concentration of colicin was determined as 125 µg/ml.

Quantitative analysis of blaTEM and blaOXA gene expression

Under the effect of colicin, the gene expression for the (blaTEM) gene in Salmonella, Klebsiella, Pseudomonas, Staphylococcus aureus, Staphylococcus epiderma, and the (blaOXA) gene in E. coli, Proteus, Enterococcus faecalis, Acentobacter, and Strepococcus was studied. Based on MIC value, the study was conducted to determine the inhibition zone under the treatment’s colicin concentration of 125 µg/ml. RT-qPCR was used to analyze the molecular expression. In brief, all isolates had their total RNA extracted using the RNeasy Mini Kit (Qiagen) in accordance with the slightly modified manufacturer’s operating instructions. To eliminate genomic DNA, Fermentas, USA’s DNase was used for the isolated RNA. Formaldehyde-denaturing 1.2% (w/v) agarose gel electrophoresis was used to assess the purity of the RNA. Utilizing the Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.), the quantities and absorbance ratios of RNA at A260/A280 and A260/A230 were determined. Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase and random hexamer oligonucleotides (Fermentas) were used to copy total RNA (0.5 µg) into single-stranded cDNA by the manufacturer’s instructions. The blaTEM and blaOXA genes were amplified from the generated cDNA. The blaTEM and blaOXA genes were amplified using the primer sequences listed in Table 1. ™SYBR Green qPCR Master Mix (Fermentas) was used for real-time PCR using a Bio-Rad MiniOpticonTM equipment. Amplification conditions are listed in Table 2. Following normalization with the 16S rRNA gene, the expression levels of the blaTEM and blaOXA genes were determined using the comparative Ct technique (2^‒∆Ct formula).

Table 1

PCR primers used in the study

Primer names	Primer sequences (5'-3')	Product size (bp)	Source of primer
Housekeeping 16S rRNA gene	F-(5' -AGAGTTTGATCATGGCTCAG-3')	355 bp	This study
	R-(5' -GCTGCCTCCCGTAGGAGT-3')
blaTEM gene	F-(5'- TCAACATTTTCGTGTCGCCC -3')	766 bp	Jiang et al. (2022)
	R-(5'- AACTACGATACGGGAGGGCT-3')
blaOXA gene	F-(5' – AATGATCTTGCTCGTGCTTC - 3')	647 bp	Noshadi and Khodavandi (2021)
	R-(5' - CATGTCCTTTTCCCATTCTG - 3')

Table 2

qPCR conditions for 16S rRNA, blaTEM and blaOXA genes for all bacteria isolate subjected in this study

Primer	Initial denaturation	Cycling condition			Final extension	Number cycle
		Denaturation	Annealing	Extension
16S rRNA	95°C for 2 min	95°C for 30 sec	53°C for 2 min	72°C for 2 min	72°C for 2 min	35
blaTEM	37°C for 15 min	95°C for 10 min	95°C for 2 min	57°C for 35 sec	72°C for 40 sec	42
blaOXA	37°C for 15 min	95°C for 10 min	95°C for 30 sec	58°C for 30 sec	72°C for 30 sec	45

Statistical analysis

The statistical analysis system-SAS program was used to detect the impact of several circumstances on the original study characteristics. ANOVA’s Least Major Difference (Dmt) test was utilized to evaluate the means in a significant way. In this study, a meaningful comparison between percentages (0.05 and 0.01 likelihood) was made using the Chung test (Ali and Bhaskar, 2016).

Isolated bacteria

All isolated bacteria were diagnosed by phenotypic appearance and biochemical tests, in addition to confirming the diagnosis using the Vitek2 Compact System. Only two E. coli isolates were found to produce colicin out of 40 isolates. In another hand for pathogenic 15 (20%) E. coli, 5 (7%) Salmonella, 8 (11%) Klebsiella, 8 (10%) Pseudomonas, 5 (7%) Staph. Epiderma, 10 (13%) Proteus, 5 (7%) Enterococcus faecalis, 5 (7%) Acinetobacter baumannii, 7 (9%) Staphylococcus aureus, 7 (9%) Strepococcus.

Determination of colicin producing E. coli isolate

The agar well diffusion method, in which the diameters of the inhibition zones around the holes were measured in millimeters, was used to investigate the production of colicin from 40 E. coli isolates. The results showed that only one of the isolates (no. 19) exhibited inhibitory activity against other bacteria (E. coli from another genus and Klebsiella), as shown in Fig. 2. This isolate was 21 mm for cultured E. coli and 22 mm for cultured Klebsiella.

Fig. 2. Colicin obtained from isolate E. coli No. 19 and tested against test bacteria, using the Agar Well Diffusion Method (The well contains 100 µl of E. coli). (A) The plate cultured with Escherichia coli of a different genus. (B) The plate cultured with Klebsiella.

Based on the data above, it is evident to us that the solid medium promotes the antagonistic relationship between the two isolates as well as the growth and dissemination of colicin inside the medium.

Antibacterial activity of colicin

The antibacterial activity of the colicin has been demonstrated against a variety of pathogenic bacteria, including Gram-positive (Staphylococcus aureus, Streptococcus, Enterococcus faecalis, and Staphylococcus epidermidis) and Gram-negative (E. coli, Salmonella, Proteus, Acinetobacter baumanni, Klebsiella, and Pseudomonas) bacteria.

In this study, the diameters of the inhibition zones were found to be between 9 and 24 mm when colicin concentrations were performed on pathogenic bacterial isolates using the agar well fusion method. These results were obtained using the dilution method with concentrations of 1000 µg/ml, 500 µg/ml, 250 µg/ml, and 125 µg/ml prepared from colicin, Table 3.

Table 3

Using the agar well diffusion method, the biological activity of colicin-producing E. coli against pathogenic isolates was assessed at various concentrations and the width of the inhibitory zone was evaluated in millimeters (mm)

No.	Concentration	Activity against test pathological bacterial isolation (diameter of the inhibition zone in millimeters [mm])
		Staph. aureus	E. coli	Salmonella	Strep.	E. faecalis	Proteus	Acinetobacter baumanni	S. epidermidis	Klebsiella	Pseudomonas
1	1000 µg/ml	21	22	20	20	23	24	21	23	22	19
2	500 µg/ml	18	19	16	17	21	18	17	20	19	16
3	250 µg/ml	14	15	14	14	17	16	15	15	16	13
4	125 µg/ml	10	11	0	9	13	12	11	10	12	10
Control		0	0	0	0	0	0	0	0	0	0

Fold of blaTEM and blaOXA gene expression of pathogenic bacteria under effect of colicin

The fold of gene expression was calculated for all bacterial isolates using (2^‒∆Ct formula). The P value was of tend for all isolates. As shown in Tables 4 and 5, the P value was highly significant for most of the pathogenic bacteria which presented the effect of colicin on the folding rate of the gene expression, for the blaTEM and blaOXA genes, respectively, leading to decreased in most bacterial isolates after treatment with colicin compared to the folding rate before treatment, as showed in Figs. 3 and 4, respectively.

Table 4

The fold change calculation of blaTEM gene expression of five selected pathogenic bacteria treated with colicn compared with untreated isolate. The P value indicates the level of significance

Type of isolate	Treatment colicin	Ct of target gene (blaTEM)	Ct of reference gene (16S rRNA)	ΔCt of blaTEM	ΔΔCt of blaTEM	Fold of gene expression(Mean ± SE)	P value
Pseudomonas	Untreated	26.65	22.01	4.64	-0.22	1.17 ± 0.08	0.021*
	Treated	28.11	22.11	6.00	1.14	0.45 ± 0.021
Salmonella	Untreated	22.88	16.12	6.76	1.9	0.27 ± 0.009	1.007NS
	Treated	22.89	16.25	6.64	1.78	0.29 ± 0.028
Klebsiella	Untreated	21.52	19.85	1.67	-3.19	9.15 ± 0.262	≤ 0.05**
	Treated	25.62	19.93	5.69	0.83	0.56 ± 0.02
S. aureus	Untreated	22.01	18.82	3.19	-1.67	3.19 ± 0.105	≤ 0.05**
	Treated	24.81	18.85	5.96	1.10	0.47 ± 0.05
S. epidermidis	Untreated	21.25	17.21	4.04	-0.82	1.77 ± 0.23	0.012*
	Treated	23.1	17.4	5.70	0.84	0.56 ± 0.04
P ≤ 0.05

*Significant, **High significant, NS, no significant.

Table 5

The fold change calculation of blaOXA gene expression of five selected pathogenic bacteria treated with colicn compared with untreated isolate. The P value indicates the level of significance

Type of isolate	Treatment colicin	Ct of target gene (blaOXA)	Ct of reference gene (16S rRNA)	ΔCt of blaOXA	ΔΔCt of blaOXA	Fold of gene expression(Mean ± SE)	P value
Proteus	Untreated	21.69	24.03	-2.34	-1.82	3.54 ± 0.325	≤ 0.05**
	Treated	26.37	24.11	2.26	2.78	0.15 ± 0.041
E. coli	Untreated	15.48	16.05	-0.57	-0.05	1.04 ± 0.95	0.027*
	Treated	17.98	16.25	1.73	2.25	0.21 ± 0.71
Streptococcus	Untreated	20.18	18.82	1.36	1.88	0.27 ± 0.065	0.16NS
	Treated	21.35	18.93	2.42	2.94	0.13 ± 0.036
Acinetobacter baumanni	Untreated	20.83	18.62	2.21	2.73	0.15 ± 0.09	0.25NS
	Treated	22.4	18.85	3.55	4.07	0.06 ± 0.008
E. faecalis	Untreated	14.26	17.36	-3.10	-2.58	5.99 ± 0.95	≤ 0.05**
	Treated	19.74	17.4	2.34	2.86	0.14 ± 0.02
P ≤ 0.05

*Significant, **High significant.

Fig. 3. The fold variation of blaTEM gene expression results showing change in gene expression (2^-∆∆Ct) values of the treated versus untreated. *P < 0.05, significant difference.

Fig. 4. The fold variation of blaOXA gene expression results showing change in gene expression (2^-∆∆Ct) values of the treated versus untreated. *P < 0.05, significant difference.

A large variety of microorganisms, even those that are resistant to many drugs, can be inhibited by colicin. In addition, these chemicals are appealing candidates for medication development since resistance does not develop during bacterial death (Fokt et al., 2022). Alternative methods of treating bacteria are required due to their rapid evolution toward multidrug resistance. To cure and treat bacterial infectious disorders, the aim of this work was to identify the E. coli bacteria that produce colicin. Because of its antibacterial properties, several studies have cited the colicin generated as the best substitute for antibiotics and suggested using them therapeutically. After being isolated from various sources, E. coli bacteria were tested for their ability to produce colicin when stimulated with mitomycin-C (Behrens et al., 2017).

Colicin has the property of killing cells, which makes it a suitable alternative to antibiotics. Traditional antibiotics work to disrupt the growth of bacteria, while colicin damages the biological components of microorganisms by preventing: DNA replication, cell wall synthesis, and protein synthesis (Francis et al., 2021). The antibacterial activity of colicin occurs through adhesion to binding sites on the outer surfaces of pathogenic bacteria and then entering the target cytoplasmic membrane. The adhesion process is facilitated by electrostatic interactions between cationic molecules and negatively charged spots on the membrane (Moravej et al., 2018). Bacteria producing colicin defend themselves by generating immune proteins that bind to the cytotoxic C-terminus domain and inhibit its function (Alonso et al., 2000). This study proved that not all E. coli isolates are able to produce colicin, which indicates that the genes responsible for production are carried on the plasmid and not on the DNA material of the bacteria. Also, colicin production only occurs under special and specific conditions that may help the bacteria to grow and resist the difficult conditions surrounding it or to increase the amount of competition in a certain environment, through which it gives an additional property to the bacteria to live and take priority in competing for nutrients in the environment. Through the results obtained in this study, it was proven to us that increasing the concentration of colicin increases the inhibition of MDR pathogenic bacteria. The effect of colicin on pathogenic bacteria varied as the fold of blaTEM gene expression differed in bacteria Salmonella, Klebsiella, Pseudomonas, Staphylococcus aureus, Staphylococcus epiderma. On the other hand, also the fold of blaOXA gene expression in E. coli, Proteus, Enterococcus faecalis, Acentobacter, and Strepococcus differ for each isolate. The effectiveness of colicin in combating MDR bacteria is intriguing because colicin is known to be effective against closely related species. Ares-Arroyo et al. (2021), found that colicin produced by E. coli bacteria were successful in combating pathogens like Staphylococcus aureus, Pseudomonas fluorescens, P. aeruginosa, Salmonella typhi, Shigella flexneri, Listeria monocytogenes, E. coli O157:H7, and Clostridium botulinum. According to Charkhian et al. (2024), colicin may exhibit a broad spectrum of activity against a wide range of related or unrelated species. It would be worthwhile to consider further exploration of the use of colicin against other bacterial species in the future. In the research by Temikotan and Daniels (2022), it was found that all indicator organisms were susceptible to colicin, but resistant to certain antibiotics in the comparative antibiotic sensitivity test. Al-mawlawi and Obaid (2017), found that colicin-producing E. coli strains showed more resistance to tetracycline, neomycin, and ampicillin compared to non-colicin producing strains. Łojewska et al. (2020), further reported colicin-producing E. coli having high levels of antibiotic resistance. The evidence has been provided by many studies that particular E. coli strains could have both colicin genes and antibiotic resistance genes (Peng et al., 2023). Daniels et al. (2023), indicated that the formation of colicin in E. coli is related to the presence of a colicogenic plasmid complex. This gives support to the fact that the trait of colicin production is linked with plasmid and the recognized plasmids are identified as Col-plasmids, each with a molecular weight of 4 kb. Colicins are effective substitutes for antibiotics especially because the mode of action of colicins is to interfere with some components of the bacterial cells to inhibit growth, which is not the same to many antibiotics for example, canamycin, penicillin and ciprofloxacin that target other activities in the bacteria. In addition, colicins are safe for use in humans, as the drug acts only on bacteria with specific receptors, which are not present in human cells. Hence colicins have a rapid action through cell killing and may destroy pathogenic cells during their active growth phase and prevent the development of resistance (Lamberti et al., 2022).

In conclusion, exploring the potential of colicins, while taking into account the accompanying risks, holds promise for addressing antibiotic-resistant pathogens and advancing the field of antimicrobial therapeutics. It is important to highlight the need for further research into the benefits of bacteriocins compared to antibiotics, in order to develop effective solutions for the urgent global health challenge of bacterial resistance. Identifying E. coli strains that produce colicins and their connection to antibiotic resistance is extremely significant. The observed strong link between colicin production and antibiotic resistance indicates that colicins could serve as natural alternatives to traditional antibiotics. Furthermore, delving into plasmid-mediated gene transfer contributes to our understanding of how colicin genes and antibiotic resistance are spread. The findings of this study have direct implications for public health.

For their partial assistance in part, the authors would like to acknowledge their affiliations.

The authors have no conflict of interest to report.